Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BetI in Enterobacteriales

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Glycine betaine synthesis
Effector: Choline
Regulog: BetI - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b0314 betT -82 6.7 TTGATTGGACGTTCAATATA
b0313 betI -66 6.6 TATATTGAACGTCCAATCAA
Citrobacter koseri ATCC BAA-895
CKO_02581 betT -236 6.7 TTGATTGGACGTTCAATATA
CKO_02582 betI -48 6.6 TATATTGAACGTCCAATCAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_00587 betT -82 6.7 TTGATTGGACGTTCAATATA
KPN_00586 betI -48 6.6 TATATTGAACGTCCAATCAA
Erwinia amylovora ATCC 49946
EAM_P133 betT -243 5.9 TTAATTGAATGCGCAATCAA
EAM_1685 betI -66 6.9 TTGATTGAACGTTCAATATA
Serratia proteamaculans 568
Spro_1512 betT -308 7 TTGATTGAACGTTCAATAAA
Spro_1513 betI -124 7 TTTATTGAACGTTCAATCAA
Erwinia carotovora subsp. atroseptica SCRI1043
ECA1743 betT -274 7 TTGATTGAACGTTCAATAAA
ECA1744 betI -103 7 TTTATTGAACGTTCAATCAA
Proteus mirabilis HI4320
PMI1462 betT -161 6.5 TTAATTGAACATTCAATCAA
PMI1461 betI -68 6.5 TTGATTGAATGTTCAATTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD