Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Enterobacteriales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b1858 znuC -49 6.5 GAAGTGTGATATTATAACATTTC
b1857 znuA -52 6.5 GAAATGTTATAATATCACACTTC
b0296 rpmE2 -34 5.6 TTATGGTTATGTTATAACATAAC
b1973 zinT -56 6.3 TATATGTTACAATATAACATTAC
b1178 pliG -53 6.3 GGATTGTTATATTATAACAGTTC
Salmonella typhimurium LT2
STM1892.S znuC -49 6.7 GAAATGTGATATTATAACATTCT
STM1891 znuA -52 6.6 AGAATGTTATAATATCACATTTC
STM0469 rpmE2 -35 5.8 TTATTGTTATGTTATAACATAAT
STM1263 zinT -54 6.2 GCAATGTTATAATATAACAATCA
STM2610 pliG -54 5.9 TTATTGTTACAATATAACAATTA
Citrobacter koseri ATCC BAA-895
CKO_01105 znuC -49 6.7 GAAATGTGATATTATAACATTCT
CKO_01106 znuA -37 6.6 AGAATGTTATAATATCACATTTC
CKO_02696 rpmE2 -35 5.5 TTATTGTTACGTTATAACATAAT
CKO_01827 zinT -91 6.8 GTGATGTTATATTATAACATTCC
CKO_04054 znuC2 -141 6.1 TTATTGTTATGTTATAACATTTT
CKO_00951 znuC2 -45 5.7 CATTTGTTATGTTATAACGTTAC
CKO_00932 dksA2 -49 6.2 TTAATGTTATGTTATAACGTTTC
CKO_00835 omr1 -45 6.3 GATATGTTATGTTATAACATATC
CKO_00850 ECA4254 -29 6.1 TAATTGTTATGATATAACATATC
CKO_00947 CKO_00947 -111 5.8 GTTATGTTATTTTATAACATCCA
CKO_00923 hisI2 -25 5.6 TTATTGTTACGTTATAACATAAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_02373 znuC -49 6.4 GTGATGTGATATTATAACATTCA
KPN_02372 znuA -100 6.3 TGAATGTTATAATATCACATCAC
KPN_00435 rpmE2 -35 5.5 TTATTGTTATGTTATAACGTAAT
KPN_04244 zinT -55 5.7 GATATGTTATATCGTAACAATTT
KPN_03035 znuC2 -108 6 TTATTGTTATGTTATAACATTAA
Enterobacter sp. 638
Ent638_2427 znuC -48 6.2 TGGATGTGATATTATAACATTCG
Ent638_2426 znuA -52 6.1 CGAATGTTATAATATCACATCCA
Ent638_0934 rpmE2 -37 5.6 CTTTTGTTATGTTATAACAAAAC
Ent638_1993 zinT -53 6.1 GATATGTTATACTATAACATCCT
Ent638_3178 znuC2 -140 5.9 TTAGTGTTATGTTATAACATTAT
Erwinia amylovora ATCC 49946
EAM_2001 znuC -48 6.1 ATTTTGTGATATTATAACATTTG
EAM_2000 znuA -52 5.9 CAAATGTTATAATATCACAAAAT
EAM_1015 rpmE2 -36 6 TTTTGGTTATATTATAACATATC
Yersinia pestis KIM
y2250 znuC -47 5.7 AAAGCGTAATATTATAACATTCA
y2249 znuA -51 5.6 TGAATGTTATAATATTACGCTTT
y1048 rpmE2 -36 5.9 ATGATGTTACATTATAACATACT
y1329 ECA3248 6 5.1 TATGTGTTACATTATAACGGTTT
Serratia proteamaculans 568
Spro_2774 znuC -50 5.8 GAGGCGTGATATTATAACATTCG
Spro_2773 znuA -51 5.7 CGAATGTTATAATATCACGCCTC
Spro_1125 rpmE2 -36 6.2 TTATTGTTATAGTATAACATTAC
Spro_1121 znuC2 -185 5.8 GTGATGTTATAATGTAACACTTA
Spro_2628 yciA -69 5.8 GATATGTTATAACATAACAAAAT
Spro_1939 dksA2 -43 6.5 GATATGTTATAATATAACAATTA
Spro_1297 omr1 -85 6 TTATTGTTATGTTATAACATAAC
Spro_1297 omr1 -80 5.7 GTTATGTTATAACATAACAAAAA
Spro_3632 ECA3248 -3 5.3 TTTATGTTACTTTATAACAATAA
Spro_3158 CKO_00947 -47 5.4 GAGATGTTTTGTTATAACGTATC
Erwinia carotovora subsp. atroseptica SCRI1043
ECA2485 znuC -46 6.4 TGTTTGTTATATTATAACATTAC
ECA2484 znuA -53 6.3 GTAATGTTATAATATAACAAACA
ECA1168 rpmE2 -31 6 GATATGTTATAACATAACAATTG
ECA3756 znuC2 -123 6.5 GATATGTTATAATATAACAATTA
ECA3248 ECA3248 -3 5.7 ATAATGTTACATTATAACGCTTT
ECA4254 ECA4254 -55 5.4 AATTTGGTATGTTATAACATACC
Edwardsiella tarda EIB202
ETAE_1442 znuC -72 6.7 GAAACGTTATATTATAACATTCC
ETAE_1443 znuA -50 6.6 GGAATGTTATAATATAACGTTTC
ETAE_1964 rpmJ2 -148 5.9 GTATTGTTATAACATAACATATG
Proteus mirabilis HI4320
PMI1151 znuC -47 6.7 GAAATGTTATATTATAACGTTTC
PMI1152 znuA -50 6.7 GAAACGTTATAATATAACATTTC
PMI3379 rpmE2 -38 6.5 ATATTGTTATATTATAACATTAC
PMI1519 ECA3248 -42 6.1 GTGATGTTATATTATAACAAAAT
PMI2619 omr2 -23 5.8 GATATGTTATAACATAACAAAAA
Photorhabdus luminescens subsp. laumondii TTO1
plu2114 znuC -48 6.6 GAATTGTTATATTATAACATCTC
plu2115 znuA -51 6.6 GAGATGTTATAATATAACAATTC
plu0036 rpmE2 -32 6.2 GTAATGTTATATTATTACAATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD