Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Enterobacteriales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b3414 nfuA -37 6.9 ATAACCAACTAAAATAGTCAACTAT
b0156 erpA -89 4.9 ATACTTGAACGAAATACCAGGGTAT
b2531 iscR -133 6.7 ATACCCGACTAAATCAGTCAAGTAA
b2531 iscR -108 5.8 ATAGTTGACCAATTTACTCGGGAAT
Salmonella typhimurium LT2
STM3511 nfuA -37 6.9 ATAACCAACTAAAATAGTCAACTAT
STM0204.S erpA -89 4.9 ATACTTGAACGAATTACCAGGGTAT
STM2544 iscR -107 6.1 ATAGTTGACCAAATTACTCGGGAAT
STM2544 iscR -132 6.5 ATACCTGACTAATTTACTCAAGTAA
Citrobacter koseri ATCC BAA-895
CKO_04835 nfuA -37 6.7 ATAACCAAGTAAAATAGTCAACTAT
CKO_03211 erpA -88 5.2 ATACTTGAATGAAATACCAGGGTAT
CKO_00250 iscR -132 6.8 ATACCTGACTAAATTAGTCAAGTAA
CKO_00250 iscR -107 6 ATAGTTGACTGATTTAGTCGGGAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03784 nfuA -37 6.5 ATAACCCAGTAAAATAGTCAACTAT
KPN_00171 erpA -89 4.7 ATACTTGAACGATTTACCAGGGTAT
KPN_02863 iscR -127 6.8 ATACCTGACTAAAACAGTCAAGTAA
KPN_02863 iscR -102 6.1 ATAGTTGACCAAATTACTCGGGAAT
Enterobacter sp. 638
Ent638_3827 nfuA -37 6.1 ATACCCAAGTATTTTAGTCAACTAT
Ent638_0696 erpA -87 5.1 ATACTTGAATGAATTACCAGGGTAT
Ent638_3028 iscR -131 6.8 ATACCTGACTAAAACAGTCAAGTAA
Ent638_3028 iscR -106 5.9 ATAGTTGACCAATTTAGTCGGGAAT
Erwinia amylovora ATCC 49946
EAM_3259 nfuA -37 6.7 ATAACCAACTGAATTAGTCAACTAT
EAM_2493 iscR -88 5.9 ATACTTGACCAATTTACTCGGGAAT
EAM_2493 iscR -138 4.9 ATAGTTGAGTAAATTACCAGGTTAA
Yersinia pestis KIM
y3903 nfuA -37 6.3 ATAACCGACAAGAGTAGTCAACTAT
y0801 erpA -103 6 GTACTTGAATGAAATACTCAGGTAT
y1333 iscR -29 5.3 ATAGTTGAGTGAATTACTAGGTTAA
y1333 iscR -4 6.6 ATAGTTGACTAAAACACTCAAGAAT
Serratia proteamaculans 568
Spro_4634 nfuA -46 5.7 ATAACCTAGTATAGAAGTCAACTAT
Spro_0783 erpA -97 5.5 ATACTTGAACGCAACACTCAGGTAT
Spro_3628 iscR -94 5.4 ATACTTGAGTAAATTACTAGGTTAA
Spro_3628 iscR -69 6.2 ATAGTTGACTGATTTACTCAGGAAT
Erwinia carotovora subsp. atroseptica SCRI1043
ECA4134 nfuA -38 5.6 ATAACCGATAAGTGCAGTCAACTAT
ECA3238 iscR -80 6.2 ATAGTTGACTAAAACACTCGGGAAT
ECA3238 iscR -105 5.2 ATACTTGAGTGTTTTACTCGGTTAA
Edwardsiella tarda EIB202
ETAE_3288 nfuA -37 5.9 ATAACCGACCGGAGAAGTCAACTAT
ETAE_2776 erpA -99 5.8 ATACTTGAATGGATTACTCGGGTAT
ETAE_2816 iscR -114 5.7 ATACCTGACTAAAATAGTAGGATAA
ETAE_2816 iscR -89 6.6 ATAGTTGACTGAAATAGTCAGGAAT
Proteus mirabilis HI4320
PMI2926 nfuA -38 6.3 ATAACCAACCAGAACAGTCAACTAT
PMI1861 iscR -88 6.2 ATACCTGACTAAAACACTCAGATAA
PMI1861 iscR -63 6.6 ATAGTTGACTAAATTACTCAGGAAT
Photorhabdus luminescens subsp. laumondii TTO1
plu0198 nfuA -37 6.3 ATAACCAACTATAGCAGTCAACTAT
plu0904 erpA -105 5.2 AAACTTGAACGAACTAATCAGGTAT
plu3284 iscR -90 5.4 ATAGTTGAGTAAATTACTAGGTTAA
plu3284 iscR -65 6.6 ATAGTTGACTAAAATACTCAGGAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD