Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AscG in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Regulog: AscG - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b2714 ascG -175 6.3 TTAAGAAACCGGTTTCACAA
b2715 ascF -177 5.1 TCAGGTGACCGGTTTCACAA
b2715 ascF -101 5.8 TTGTGAAACCGGTTTCTTAA
Citrobacter koseri ATCC BAA-895
CKO_02999 celA2 -117 5.6 TACTGCAACCGGTTTCAGTT
CKO_04069 ascG -172 6.7 ATAGGAAACCGGTTCCACAA
CKO_04070 ascF -103 5.1 TTGTGGAACCGGTTTCCTAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03050 ascG -194 6.7 ATAGGAAACCGGTTCCACAA
KPN_04054 celA -72 4.6 AATGGAAACCGGTTTCCGTC
KPN_04054 celA -198 4.3 TTTGGAAACCGATTTTCCAT
KPN_04369 celA2 -151 5.8 AAATGAAACCGGTTTCAATT
KPN_03051 ascF -93 5.1 TTGTGGAACCGGTTTCCTAT
Enterobacter sp. 638
Ent638_0526 bglF -202 5 TACAGTAACCGGTTGCAGAG
Ent638_0038 celA -72 4.7 AATGGAAACCGGTTTCCATA
Ent638_0200 celA2 -126 5.4 AATTGAAACCGGTTTCATAG
Ent638_3187 ascG -182 6.7 ATAGGAAACCGGTTTCACAA
Ent638_3188 ascF -52 5.6 TTGTGAAACCGGTTTCCTAT
Ent638_0526 bglF -215 5.5 CACGGAAACCGGTTACAGTA
Erwinia amylovora ATCC 49946
EAM_2929 ascG -297 6.1 TTCTGCAACCGGTTTCATAT
EAM_2930 bglE -68 6.6 ATATGAAACCGGTTGCAGAA
Serratia proteamaculans 568
Spro_4224 bglE -86 5.4 TACTGAAACCGGTTGCTGTT
Spro_4224 bglE -99 4.9 CCCTGCAACCGGTTACTGAA
Spro_0576 ascF -113 5.8 TTGTGAAACCGGTTTCTTAT
Spro_0577 ascG -193 6.5 ATAAGAAACCGGTTTCACAA
Erwinia carotovora subsp. atroseptica SCRI1043
ECA4436 ascG -164 6.4 ATATGCAACCGGTTTCATAT
ECA2488 celB -242 4.5 ATGGAAAACGGTTTCCATAT
ECA2164 ascG -173 6 ATGGGTAACCGGTTCCACAT
ECA2165 ascF -180 5.1 ATGTGGAACCGGTTACCCAT
ECA4435 bglE -69 6.6 ATATGAAACCGGTTGCATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD