Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Enterobacteriales

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b0484 copA -67 6.6 ACCTTCCCCTTGCTGGAAGGT
b0123 cueO -73 6.4 ACCTTCCCGTAAGGGGAAGGA
Salmonella typhimurium LT2
STM0498 copA -97 6 ACCTTAACCTTGCTGGAAGGT
STM0499 cueR -33 5.4 ACCTTCCAGCAAGGTTAAGGT
STM0168 cueO -62 6.5 ACCTTCCCGTTAGGGCAGGGT
Citrobacter koseri ATCC BAA-895
CKO_02665 copA -67 6.2 ACCTTCCCCTTGATGGAAGGT
CKO_03244 cueO -73 6.7 ACCTTCCCGTAAGGGGAGGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_00464 copA -40 6.6 ACCTTCCCCTTGCTGGAAGGT
KPN_00465 cueR -33 6.2 ACCTTCCAGCAAGGGGAAGGT
KPN_00131 cueO -62 6.4 ACCTTCCCGTTACGGTAGGGT
Enterobacter sp. 638
Ent638_0962 copA -95 6 ACCTTAACCTTGCTGGAAGGT
Ent638_0963 cueR -33 5.4 ACCTTCCAGCAAGGTTAAGGT
Erwinia amylovora ATCC 49946
EAM_1044 copA -83 5.6 ACGTTCCCCTTGATGGAAGGT
EAM_1045 cueR -33 5.4 ACCTTCCATCAAGGGGAACGT
EAM_0777 cueO -62 6.2 ACCTTCCCGCTGGGGCAGGGT
Yersinia pestis KIM
y1093 copA -194 6.3 ACCTTCACCTTGCTGGAAGGT
y1094 cueR -33 5.6 ACCTTCCAGCAAGGTGAAGGT
y0777 cueO -210 6.4 ACCTTCCCCTAAGAGGAGGGT
Serratia proteamaculans 568
Spro_1150 copA -93 6.6 ACCTTCCCCTTGCTGGAAGGT
Spro_1151 cueR -33 6.2 ACCTTCCAGCAAGGGGAAGGT
Spro_3999 cueO -118 6.3 ACCTTCCGCTAAGGGGAGGGT
Erwinia carotovora subsp. atroseptica SCRI1043
ECA1193 copA -103 5.8 ACCCTCCCCTTGCTAGAAGGT
ECA1194 cueR -33 5.6 ACCTTCTAGCAAGGGGAGGGT
Edwardsiella tarda EIB202
ETAE_1039 copA -115 6.1 ACCTTAACCTTGCGGGAAGGT
ETAE_1040 cueR -33 5.7 ACCTTCCCGCAAGGTTAAGGT
Proteus mirabilis HI4320
PMI2173 copA -122 6.2 ACCTTCCCCTTGCGGAAAGGT
PMI2172 cueR -33 6.2 ACCTTTCCGCAAGGGGAAGGT
PMI0159 cueO -108 5.6 ACCTTCCAGTAAGGGGAGACT
Photorhabdus luminescens subsp. laumondii TTO1
plu3823 cueR -33 6 ACCTTCCCTCAAGGGTAAGGT
plu3824 copA -129 5.9 ACCTTACCCTTGAGGGAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD