Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GalR/GalS in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor (activator)
Biological process: Galactose utilization
Effector: Galactose
Regulog: GalR/GalS - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b0759 galE -96 6.6 TTGTGTAAACGATTCCACTA
b2151 galS -113 5.5 GGCTGTAACCGTTTCCATTG
b2943 galP -282 5 AACTGAAACCGATTACACCA
b2943 galP -100 6.2 TAGTGTAAGCGATTACACTG
b2150 mglB -287 5.3 CGATGTAACCGCTTTCAATC
b4227 ytfQ -147 4.6 AGATGAAAGCGATTACAAAC
b4227 ytfQ 0 4.5 ATGTGGAAACGCTTACTTAT
b2837 galR -32 5.2 GAATGTAAGCGTTTACCCAC
Salmonella typhimurium LT2
STM0776 galE -96 6.4 GTGTGTAAACGATTCCACTA
STM2191 galS -121 5.4 GGCTGTAACCGTTTCCATCC
STM3091 galP -283 4.7 TCATGAAAGCGGTTACATTC
STM3091 galP -101 6.1 CAGTGTAAACGATTACACCA
STM3011 galR -33 5.3 TAATGTAAGCGTTTACCCAC
Citrobacter koseri ATCC BAA-895
CKO_00640 galS -124 4.9 GCATGTAACCGTTTCCAGCC
CKO_04318 galP -282 5.2 TAATGAAACCGTTTACCCTC
CKO_04318 galP -101 6.6 TAGTGTAAACGATTACACTA
CKO_00641 mglB -287 5.5 GGATGTAACCGCTTTCAATA
CKO_03603 ytfQ -148 4.7 GAATGAAAGCGATTACAAAG
CKO_03603 ytfQ 0 4.6 ATGTGGAAGCGCTTACTTTT
CKO_04211 galR -33 5.1 AAATGTAAGCGTTTACCCAC
CKO_02603 ECA1400 -38 4.9 ATTTGTAATCGATTACTTTT
CKO_02603 ECA1400 -70 5.1 TTTTGTAATCGATTACTTTT
CKO_02376 galE -54 6.4 AAGTGTAAACGATTCCACTA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_00773 galE -96 6.4 AAGTGTAAACGATTCCACTA
KPN_00773 galE -252 4.9 CAGTGGAGACGGTTACACTT
KPN_02589 galS -127 5.2 GGATGTAAACGTTTCCAGCC
KPN_03376 galP -285 4.7 AAATGAAAGCGATTACATAG
KPN_03376 galP -102 5.6 TTGTGGAAACGATTACACAG
KPN_02588 mglB -256 5.4 GGATGTAACCGCTTTCAATT
KPN_04622 ytfQ -283 5.8 TTATGTAACCGTTTTCATTG
KPN_04622 ytfQ -42 4.2 ATGTGGAAGCGCTTACTTCT
KPN_03246 galR -33 5.5 GTATGTAAACGCTTACCCTA
KPN_00538 ECA1400 -35 5.1 TTTTGTAATCGATTACTTTT
KPN_00538 ECA1400 -66 5.1 TTTTGTAATCGATTACTTTT
Enterobacter sp. 638
Ent638_2751 galS -127 5.5 GGATGTAACCGTTTTCATCT
Ent638_3347 galP -284 5 AAATGAAAGCGATTACACCA
Ent638_3347 galP -102 6.3 TAGTGTAACCGATTACACCA
Ent638_2750 mglB -288 5.8 TGATGTAACCGTTTTCAATC
Ent638_0412 ytfQ -148 4.9 GAATGAAAGCGATTACAAAC
Ent638_0412 ytfQ -94 4.3 TGATGTAACGCATTCCGTTA
Ent638_0412 ytfQ 0 4.1 ATGTGGAAGCGCTTACTACT
Ent638_3278 galR -35 5.3 GTGTGTAAACGCTTACCCCC
Ent638_1060 ECA1400 -37 5.1 TTTTGTAATCGATTACTTTT
Ent638_1060 ECA1400 -68 5.1 TTTTGTAATCGATTACTTTT
Ent638_1250 galE -96 6.2 CGGTGTAACCGATTCCACTA
Erwinia amylovora ATCC 49946
EAM_1197 galT -197 5.1 CTATGTAATCGTTTTCAACA
EAM_1197 galT -108 6.4 TAGTGTAAACGATTCCATTT
EAM_2208 galS -128 4.9 GGCTGTAACCGTTTTCATGG
EAM_2827 galP -170 5.6 TGTTGTAACCGGTTACATTC
EAM_2770 galR -35 4.9 AAATGTAAACGCTTACCCAG
Yersinia pestis KIM
y2662 mglB -229 5.8 TTGTGTAACCGGTTTCAATC
y3183 galR 32 5.4 TGATGTAAGCGGTTACCCTA
y3043 galE -95 6.4 GAGTGTAAACGATTCCATTA
Serratia proteamaculans 568
Spro_1562 galS -102 5.4 GTATGTAAACGTTTTCTTTC
Spro_1160 galP -274 4.3 GTGTGATATCGGTTACATTT
Spro_1160 galP -100 6.1 TTGTGTAATCGTTTCCACTA
Spro_1563 mglB -246 6.1 TTGTGTAACCGTTTTCAATC
Spro_3832 galR -34 5.2 GAATGTAAGCGATTACCCAG
Spro_1292 galT -50 5 AGGTGAAAGCGATTACACAC
Spro_1292 galT -160 6.1 CTGTGTAAACGATTCCATTT
Erwinia carotovora subsp. atroseptica SCRI1043
ECA3172 galR -240 5.3 AAGTGTAATCGGTTACCCTA
ECA3175 ganE -229 4.8 TGGTGTAACCGTTACCCTAG
ECA3175 ganE -335 5.6 TGGTGTAACCGTTTGCACAA
ECA3174 ganK -178 5.3 TTGTGCAAACGGTTACACCA
ECA1400 ECA1400 -34 5.1 GATTGTAATCGATTACTTTT
ECA1400 ECA1400 -64 5 AAAAGTAATCGATTACATTT
ECA3171 galT -240 6 TAGGGTAACCGATTACACTT
ECA3171 galT -152 5 TAGTGAAACTGATTACATTG
Edwardsiella tarda EIB202
ETAE_2966 galP -273 5.6 AAGTGAAAACGATTACATTT
ETAE_2966 galP -79 6 GTATGTAAACGATTACATTT
ETAE_2890 galR -41 5.2 TGGTGTAAACGTTTACGGTT
ETAE_2564 galE -95 6.4 TAGTGTAAACGATTCCATTT
ETAE_2564 galE -195 5.5 TAGTGTAAGCGATACCACAA
Proteus mirabilis HI4320
PMI1951 galE -126 6.1 GCGTGTAAACGTTTACACTA
PMI1951 galE -259 5.3 TAATGTAATCGTTTACTTTT
PMI1947 galR -168 5.3 AAGTGTAAACGCTTTCCTTT
PMI1946 sglT -58 5.7 AAGTGGAAACGTTTACATTA
PMI1946 sglT -249 4.8 TATTGTAACCGTTATCAAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD