Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator TyrR in Enterobacteriales

Properties
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b1323 tyrR -89 3.7 GTGTCAATGATTGTTGACAG
b2601 aroF -165 5.4 GTGTAAATTTATCTATACAG
b2601 aroF -113 5.4 GTGTAAATAAAAATGTACGA
b2601 aroF -90 4 ATGGATTGAAAACTTTACTT
b0048 folA -182 4.5 ACGTAAATCACACTTTACAG
b0929 ompF -75 5 CCGTAAATTTTTATTGACAG
b3161 mtr -129 5.3 CTGTAAAATAATATATACAG
b1907 tyrP -110 5.6 TTGTACATTTATATTTACAC
b0112 aroP -89 5 ATGTAAACAAATTAATACAA
b0388 aroL -182 5.6 ATGTAATTTATTATTTACAC
b0388 aroL -106 5 GTGGAATTTTTTCTTTACAA
Salmonella typhimurium LT2
STM1683 tyrR -89 4.2 CTGTCAATATTTGTTGACAG
STM2670 aroF -164 4.5 GTGTAAAGTTTTTGATACGA
STM2670 aroF -113 5.3 GTGTAAAGTTTATTTTACGT
STM2670 aroF -90 4 ATGGATTGAAATCTTTACTT
STM0999 ompF -77 4.7 CTGTAAAGTTTTATTGACGG
STM1937 tyrP -110 5.1 CTGTAAATTTTACAGTACAC
STM3279 mtr -129 5.2 GCGTAAAGTAAAATATACAG
STM0150 aroP -108 5.2 TTGTAAATAAATCAATACAA
STM0388 aroL -181 5.4 ATGTAATGAAAAATTTACAG
STM0388 aroL -107 5.8 GTGTAAATTATTATTTACAT
STM2405 ipdC -100 4.5 CTGTAAACATTGTTTTCCAG
Citrobacter koseri ATCC BAA-895
CKO_02783 aroL -163 5 GTGGAATGATTTATTTACAT
CKO_03921 aroF -89 4 GTGGATTGAAATCTTTACCG
CKO_01393 tyrR -90 4.2 CTGTCAATAATTGTTGACAG
CKO_03921 aroF -165 5.3 ATGTAAATTTTTATGTACGA
CKO_03921 aroF -112 5.4 ATGTAAAGTAAAATTTACGG
CKO_04558 mtr -129 5.1 CCGTAAAGTAAAATATACAG
CKO_02137 ompF -76 5 ccGTAAATTTttATTgACAg
CKO_03376 COG2814 -65 4.9 TAGTAATTTTTGATTTACAC
CKO_03376 COG2814 -87 4.4 GAGTATTGAATTGTTTACGA
CKO_01040 tyrP -83 4.6 TCGTAAACAATGGTATACAC
CKO_02783 aroL -238 5.4 ATGTAATGTTATTTTTACAC
CKO_03262 aroP -87 5 GcGTAAAcaTAttaaTACAa
CKO_03467 tpl -307 4.3 CTGGAAAGTTAAGTTTTCAC
CKO_00409 ipdC -101 3.8 CTGTAAATCCTGCTTTCCAC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_01305 tyrR -90 4.2 CTGTCAATAATTGTTGACAG
KPN_02923 aroF -90 4 ATGGATTGAATTCTTTACTT
KPN_02923 aroF -166 4.9 GTGTAAATATTGTTATACGC
KPN_00010 COG2814 -60 4.4 TAGTGATTTTTACTTTACAC
KPN_00010 COG2814 -82 3.9 GTGTGCCGTTTTATTTACGA
KPN_02923 aroF -113 5.7 GTGTAAATTAAAATTTACGG
KPN_02404 tyrP -110 5.3 ATGTAAACATTTCATTACAC
KPN_03569 mtr -128 4.9 GCGTAAACTAAATAATACAG
KPN_00116 aroP -192 4.8 CCGTAAACAAAACAATACAG
KPN_00332 aroL -165 4.6 ATGCAATGATAAGTTTACAT
KPN_00332 aroL -101 5.3 GTGTAATTTTTTCTTTACGT
KPN_02740 ipdC -97 5 GCGTAATTATTGCTTTACAC
Enterobacter sp. 638
Ent638_3080 aroF -112 5.7 GTGTAAATTAAAATTTACGG
Ent638_3080 aroF -89 4 TTGGATTGAAATCTTTACTG
Ent638_2152 tyrR -86 3.7 CTGTCAATATCTGTTGACAG
Ent638_3080 aroF -165 5.4 CTGTAATTTTATGTTTACGA
Ent638_1448 ompF -77 4.5 CCGGAAATATTTATTGACAG
Ent638_0572 COG2814 -37 4.4 CTGTAAAATTAAATCAACAA
Ent638_0572 COG2814 -60 4.9 TAGTAATTTTTTCTTTACGA
Ent638_2489 tyrP -44 5.1 TCGTAAACATTTCATTACAC
Ent638_3598 mtr -128 5.2 GCGTAAAGTAATATATACAG
Ent638_0658 aroP -87 4.4 CCGTAACGAAATAAATACAT
Ent638_0658 aroP -64 4.5 ATGGAATTTCATAATTACAC
Ent638_0859 aroL -108 4.9 CTGTAATCCAATTTTTACAA
Ent638_0859 aroL -182 4.5 ATGCAATGATTTCTTTACAG
Erwinia amylovora ATCC 49946
EAM_1834 tyrR -96 3.9 CTGTCAACTTTTCATGACAG
EAM_2621 aroF -73 4 ATGTACTCATTATGGTACAG
EAM_0932 aroL -126 4.5 CTGTAAATAAAACGTTACTG
EAM_2621 aroF -202 5.3 CTGTAATCTTTTATTTACGC
EAM_2621 aroF -106 4.1 CTGGTAATTAATGTGTACAC
EAM_0745 aroP -187 4.4 GCGTAAAGTTTCCAATACAC
Yersinia pestis KIM
y0903 aroF -114 5.2 TAGTAATTATTTATTTACAA
y0903 aroF -92 4.5 ATGGATTGAAAACTTTACAT
y3709 COG2814 -68 4.2 TAGTCATGTTAACTTTACAA
y2979 tyrP -266 5.4 tcGTAAAcTatAATTTACAC
y0765 aroP -234 5.3 GTGTAATTAAATGATTACAT
y0972 aroL -174 5 GTGTATTATTAATTTTACGT
Serratia proteamaculans 568
Spro_2617 tyrR -98 3.6 CTGTCAACTTTTGCTGACAG
Spro_0879 aroF -99 4.6 TCGGATTTAAAACTTTACAT
Spro_0879 aroF -122 5.1 TGGTAATTTTTTATTTACAG
Spro_1018 aroL -122 4.9 TCGTAAATATTGAAATACAG
Spro_0690 COG2814 -65 4 TAGTAAGGATTCGTTTACAG
Spro_0690 COG2814 -87 3.7 GTGTGAAAATAATTTGCCGT
Spro_3276 tyrP -124 4.8 GCGTAAACTTAAGTTAACAC
Spro_4013 aroP -80 4.4 CCGTAAATAAAACAAAACAC
Erwinia carotovora subsp. atroseptica SCRI1043
ECA3352 aroF -133 4.6 GTGGATTTAAATCTTTACGG
ECA3352 aroF -156 5.2 TGGTAATTTTTTATTTACAC
ECA3884 COG2814 -68 5 TAGTAATTTATACTTTACAC
ECA3884 COG2814 -90 4 GTGTATAAAAATTTTGCCGA
ECA1218 tyrP -235 5.8 GTGTAAATATAAAATTACAC
ECA3791 aroP -93 5.4 CCGTAAAAATAAAATTACAC
Edwardsiella tarda EIB202
ETAE_2837 aroF -129 4.6 GTGTAAAGATGAATGTACGA
ETAE_2837 aroF -95 4 ATGGATTGAAAAGTTTACTG
ETAE_0574 COG2814 -66 3.7 TTATATTTCTATTTTTGCAA
ETAE_2837 aroF -117 4.6 ATGTACGATATTGTTTACAT
ETAE_2350 tyrP -106 5.1 GTGTAAATGAATAATTACAT
ETAE_0657 aroP -91 5.4 ATGTAAAAATAAAATTACGA
Proteus mirabilis HI4320
PMI0387 aroF -244 5.6 GTGTAAAATTAAAATTACAG
PMI1369 tyrR -96 3.7 GTGTCAACTTTTGCTGACAA
PMI1596 aroP -51 5.1 TCGTAAACATTGATTTACAC
PMI0387 aroF -127 5.2 ATGTAAACATATGATTACGA
PMI0387 aroF -85 4.5 ATGGATTGATTTCTTTACAT
PMI1738 tyrP -106 5.3 TTGTAAACAAAACATTACAC
PMI1738 tyrP -83 4.7 TCGTAATTAAAATTTGACAG
PMI0371 aroL -57 5.5 TTGTAAATTTTAGATTACAC
Photorhabdus luminescens subsp. laumondii TTO1
plu2580 tyrR -178 3.7 TTTTATAATCAATCTTACAA
plu1262 aroF -98 4.3 TTGGATTGTATTCTTTACGA
plu1262 aroF -140 5.5 TTGTAAACAATAATTTACAG
plu3066 tyrP -110 5.7 TTGTAATTATTTATTTACAC
plu1245 aroL -69 4.1 ATGTAAATTTCTGGTTACTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD