Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Crp in Enterobacteriales

Properties
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Regulog: Crp - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b3365 nirB -76 3.4 GAATTTGATTTACATCAATAAG
b3365 nirB -124 3.2 AAAATTTATACAAATCAGCAAT
b3357 crp -136 3.3 GTATGCAAAGGACGTCACATTA
b3357 crp -154 3.3 TACATTGATGTACTGCATGTAT
b2344 fadL -269 4.8 ATAAGTGACCGAAATCACACTT
b2344 fadL -247 3.9 AAAAATGATCTAAAACAAAATT
b2153 folE -101 3.8 TTATGTGCGCCGCCTCACGCAC
b3599 mtlA -162 5.4 TTATGTGATTGATATCACACAA
b0584 fepA -36 3.2 AGTTGCAATTCGTGGCAAAAAT
b3243 aaeR -37 5.3 TTATGTGATCTAAATCACTTTT
b4069 acs -100 4.1 TTGCGTGATCTGTCGCCCAAAT
b3072 aer -104 5 AATTGCGATCTAAATCAAATTA
b1415 aldA -112 4.3 TTTTATGAAGCCCTTCACAGAA
b2957 ansB -125 4 TTTTGTTACCTGCCTCTAACTT
b4055 aphA -130 3.6 CATCCTGCTTTTCATCACAAAA
b4055 aphA -57 4 TTTTGCAACAAATCTCACAATA
b0063 araB -131 3.9 TTATTTGCACGGCGTCACACTT
b0064 araC -229 4.4 AAGTGTGACGCCGTGCAAATAA
b2841 araE -131 4.4 AATTGGAATATCCATCACATAA
b1901 araF -163 4.2 CGATGTGATATTGCTCTCCTAT
b3957 argE -66 3.7 TAGTGTATTTTTATTCATAAAT
b1704 aroH -106 4.3 AGGTGTGACACACCTCGCACTT
b1704 aroH -64 4 TATCGTGATGCGCATCACTTCC
b2715 ascF -177 4.2 TCAGGTGACCGGTTTCACAAAT
b4139 aspA -206 4.5 AGCGGTGATCTATTTCACAAAT
b4139 aspA -156 4.2 TAAAGTGATCCAGATTACGGTA
b3739 atpI -263 4.8 ATATGTGATCTGAAGCACGCTT
b1963 b1963 -287 4.6 TGGTGTGATCAGGCGCACATTA
b2462 b2462 -103 4.6 CTTAGTGATCTACCTCACCTTT
b3570 bax -189 4.2 TTTTGCGATAACCCCCACATTT
b3570 bax -72 4.4 ATTTGAGATTCAACTCTCAAAT
b3723 arbG -202 3.7 AACTGCGAGCATGGTCATATTT
b3723 arbG -185 3.6 TATTTTTATCAATAGCGCATTG
b0040 caiT -278 4.3 TATTGTTTTATGGATCACCAAT
b0040 caiT -246 3.6 AGATGTTATTTTTTACTCACAA
b0040 caiT -158 5.2 AAATGTGATACCAATCACAGAA
b2143 cdd -128 4.3 ATTTGCGATGCGTCGCGCATTT
b2143 cdd -78 5.1 TAATGAGATTCAGATCACATAT
b1661 cfa -80 3.8 TTCTGCGAGATTTCTCACAAAG
b1738 chbB -201 3.7 AAATGTGAAGAGGGTCATAACC
b0881 clpS -164 4 AAATTTGAAGCAGTTAACGCTA
b4213 cpdB -118 3.8 AACTGTGATAGTGTCATCATTT
b4213 cpdB -85 3.8 AATTGTGGCATTCTTCACTGTT
b4397 creA -81 3.7 TATTGAGATTTTGTTCTTAATC
b0880 cspD -180 4 TAGCGTTAACTGCTTCAAATTT
b0623 cspE -114 4 TAACGCGACTTTTATCACTTTT
b0598 cstA2 -139 3.7 CGGAGTGATCGAGTTAACATTG
b4208 cycA2 -198 4.7 TTTTGTGAGCTGTTTCGCGTTA
b0733 cydA -300 3.6 TAAATTGTTCTCGATCAAATTG
b0733 cydA -255 3.6 TAAATTGATCACCGTCGAAAAA
b0432 cyoA -245 3.8 ATAATTGTTTTATTTCACATTG
b4214 cysQ -126 3.6 AACAGTGAAGAATGCCACAATT
b3934 cytR -128 3.9 AAATTCAATATTCATCACACTT
b2010 dacD2 -99 4.3 AAATGAGAGGGTAGTCACATTT
b1189 dadA -116 4.7 AGATGTGAGCCAGCTCACCATA
b3528 dctA -143 4.1 TTGTGCGAGCCAGCTCAAACTT
b4381 deoC -149 4.6 TTATTTGAACCAGATCGCATTA
b4381 deoC -96 4.5 AATTGTGATGTGTATCGAAGTG
b4479 dgoR -154 4.2 TTTTGTGATCTAAATTGTAGTA
b2364 dsdC -115 3.9 TGGAGTGATTTACATCTAAAAA
b2364 dsdC -85 4.6 AATTGAGATATGGTTCACTTTA
b2365 dsdX -154 4.4 TAAAGTGAACCATATCTCAATT
b3260 dusB -297 4.4 AAGTGCGAGCAAGCTCACAAAA
b3260 dusB -212 4.3 AATTGAGAACTTACTCAAATTT
b2927 epd -213 4.7 AAGTGTGATGTGAGTCAGATAA
b3093 exuT -274 4.2 TTTCGTGAGTTAGATCAATAAA
b3093 exuT -152 5.1 ATTTGTGATGGCTCTCACCTTT
b1805 fadD -131 3.7 AATAGTGACGCGCTTCGCAACC
b3081 fadH -112 3.9 CTTTTTGAATCCCATCACAAAC
b1187 fadR -21 3.9 CTGTGTTATGGAAATCTCACTA
b4232 fbp -163 3.9 TTTTTTAATCTGCCGCTCATTT
b0518 fdrA -213 3.8 TTATTTGATAATCCGCTCACTT
b0518 fdrA -105 4.7 CTGTGTGATATTCATCACCTTA
b0041 fixA -215 4.1 ATTGGTGATCCATAAAACAATA
b0041 fixA -158 4 ATTGGTGAGGAACTTAACAATA
b1892 flhD -280 5.1 TTGTGTGATCTGCATCACGCAT
b0904 focA -156 3.6 TATTTTTATTTGGATAATCAAA
b0904 focA -78 3.8 AGATATGATCTATATCAATTTC
b2169 fruB -178 4.3 AATTGTGCAGCACATCAAACTT
b3949 frwC -202 4 ATTTGCGACGCGTCTCACAAGA
b3949 frwC -147 4.3 AGTTATGAGGCGGATCGCATTT
b3949 frwC -57 3.9 TATTGTTTCCTCCATCAAAAAT
b0479 fsr -65 3.7 TAGTCTGGTAATAATCACAAAT
b2800 fucA -144 4.1 TTAGTTGAACCAGGTCACAAAA
b2800 fucA -54 4 TAGTGTGAAAGGAACAACATTA
b2801 fucP -207 4.9 TAAAGTGATGGTAGTCACATAA
b2801 fucP -167 4.5 AAGTGTGACCGCCGTCATATTA
b4140 fxsA -202 4.1 TACCGTAATCTGGATCACTTTA
b4140 fxsA -152 4.3 ATTTGTGAAATAGATCACCGCT
b0759 galE2 -78 3.8 TAATTTATTCCATGTCACACTT
b2943 galP -156 3.6 TATGATGATATAACTCAATTAT
b2943 galP -82 4.9 TGATGTGATTTGCTTCACATCT
b1779 gapA -226 5.3 AATCGTGATGAAAATCACATTT
b3128 garD -210 4.2 TATTTTGAGCATATGCACATAA
b3128 garD -127 4.4 ATGATTGACATTGATCACATTT
b3128 garD -52 3.7 AAATGAGACCAGGTCCTCATTT
b3127 garP -269 4.4 AAATGTGATCAATGTCAATCAT
b2388 glk -116 4.1 TTGTGTGACCCAGATCGATATT
b3870 glnA -269 4.2 CTTTGTGATCGCTTTCACGGAG
b2241 glpA -165 4.6 AAATGTGAATTGCCGCACACAT
b3426 glpD -116 4.4 TAATGTTATACATATCACTCTA
b3425 glpE -95 4.7 TAGAGTGATATGTATAACATTA
b3927 glpF -142 4 TTTTATGACGAGGCACACACAT
b2240 glpT -219 3.7 TTGTTTGATTTCGCGCATATTC
b2240 glpT -179 3.6 AAACGTGATTTCATGCGTCATT
b2240 glpT -129 4.6 ATGTGTGCGGCAATTCACATTT
b2551 glyA -229 3.8 GAATGTGATGAAGTGAAAAATT
b3437 gntK -132 4.8 AAATTTGAAGTAGCTCACACTT
b3212 gltB -199 4.2 AATTTTGCGCTAAAGCACATTT
b3805 hemC -236 4.2 AAACGTGATCAATTTAACACCT
b1237 hns -229 4.1 AAATGTGACATGAATCAGGAAG
b0125 hpt -147 5.3 ATGTGTGATCGTCATCACAATT
b4267 idnD -81 5.1 TGACGTGATCTTCATCACAAAT
b0118 acnB -144 3.5 TTTTGTAAACAGATTAACACCT
b0344 lacZ -110 4.7 TAATGTGAGTTAGCTCACTCAT
b1677 lpp -56 3.6 TTGTGTAATACTTGTAACGCTA
b2289 lrhA -189 4.2 TTCTGTGATCTACTTCAGGCAT
b1513 lsrA -183 4.3 ATCTGTGATGGCAACCACAGTT
b0459 maa -97 4.8 CTATGTGATCTTTATCACACAG
b2463 maeB -257 3.9 ATGAGTGCGTTAATTCACACTT
b4034 malE -195 4.4 TTTCGTGATGTTGCTTGCAAAA
b4034 malE -161 4 TTATGTGCGCATCTCCACATTA
b4034 malE -132 4.3 TTCTGTAACAGAGATCACACAA
b4035 malK -254 4.4 TTGTGTGATCTCTGTTACAGAA
b4035 malK -225 3.9 TAATGTGGAGATGCGCACATAA
b4035 malK -191 3.7 TTTTGCAAGCAACATCACGAAA
b3417 malP -141 4.5 TTAAGTGGTTGAGATCACATTT
b3571 malS -269 4.2 ATTTGAGAGTTGAATCTCAAAT
b3571 malS -152 4.1 AAATGTGGGGGTTATCGCAAAA
b3571 malS -118 3.6 TTGCGCGAGATCGCTCACCCTT
b3418 malT -142 4.3 AATTGTGACACAGTGCAAATTC
b1621 malX -154 4.1 TTATGTGACAGATAAAACGTTT
b1621 malX -94 4.4 TAATGTGATTTATGCCTCACTA
b1818 manY -60 3.8 TATTGTGTTGATTATCACTCAG
b2150 mglB -270 4.5 ATCTGTGAGTGATTTCACAGTA
b2813 mltA -164 3.9 TTTTTTTACCCCGATCACGGAT
b2701 mltB -184 4.6 AAGTGTTATTTTGATCGCAAAA
b0678 nagB -212 4.3 AAATTTAATTCGTATCGCAAAT
b0678 nagB -178 4.6 TTTTGTGAGTTTTGTCACCAAA
b0679 nagE -176 4.4 TTTGGTGACAAAACTCACAAAA
b0679 nagE -142 4.2 ATTTGCGATACGAATTAAATTT
b3225 nanA -115 4.6 TTTAGTGAAGCAGATCGCATTA
b1109 ndh -154 3.9 AAACTTGATTAACATCAATTTT
b3397 nudE -53 3.7 AAGCGTGTCCGATATCGCACAA
b2393 nupC -183 4 TAATGTTAGCACATTTACATAA
b2393 nupC -84 3.8 TAGTGTGTGTCAGATCTCGTTT
b2393 nupC -31 4.1 AAATTTAACCTGCCTCATATTT
b2964 nupG -166 5.2 AAATGTTATCCACATCACAATT
b2964 nupG -116 3.8 TTATTTGCCACAGGTAACAAAA
b0957 ompA -188 4 ATGCCTGACGGAGTTCACACTT
b0929 ompF -242 4.4 AAATATGACGGTGTTCACAAAG
b3599 mtlA -206 4.5 TTTTGTGATGAACGTCACGTCA
b3405 ompR -183 3.9 TAACGTGATCATATCAACAGAA
b1256 ompW -166 4.9 AAAATTGATTTAAATCACATTA
b1256 ompW -82 3.8 TAATGTGATCTATGTAGGATCA
b4376 osmY -266 4.4 AATTGTGATCTATATTTAACAA
b3403 pck -240 4.2 GAATGCGATTCCACTCACAATA
b3403 pck -137 4 TTTCGTGACAGGAATCACGGAG
b0113 pdhR -131 3.8 AAATGTGCACAGTTTCATGATT
b1127 pepT -73 3.6 AAAAGTGACCTGACGCAATATT
b3363 ppiA -204 4.2 TTTTGTGATCTGTTTAAATGTT
b3363 ppiA -151 4.2 AGAGGTGATTTTGATCACGGAA
b1101 ptsG -154 4.4 AAACGTGATAGCCGTCAAACAA
b2415 ptsH -209 3.9 TTTTATGATTTGGTTCAATTCT
b1015 putP -207 3.6 AAATGTGAGAGAGTGCAACCTG
b1951 rcsA -201 4 TGTTTTAAGCTCACTCACATAT
b3904 rhaB -162 3.8 AAATGCGGTGAGCATCACATCA
b3904 rhaB -127 4.4 AATTGTGAACATCATCACGTTC
b3905 rhaS -182 4.5 GAACGTGATGATGTTCACAATT
b3905 rhaS -147 4.5 TGATGTGATGCTCACCGCATTT
b3907 rhaT -145 4.1 AGATGTGAAGCAAATCACCCAC
b0610 rnk -140 3.8 GAATGTGACGCAAATCACTTCA
b2796 sdaC -179 4.2 ATTTGAGATCAAGATCACTGAT
b2913 serA -210 4.1 TTTGGTGACATGTGTCACGCTT
b2170 setB -211 4.6 AAGTTTGATGTGCTGCACAATT
b3908 sodA -161 3.8 GTGGGTGATTTGCTTCACATCT
b2175 spr -130 4.1 TTTTGTGCGTTAGTCCACAGAT
b2702 srlA -93 4.4 TTTTGCGATCAAAATAACACTT
b2464 talA -83 4 TTTTTTGATGCGTTTAGCGAAA
b2464 talA -53 3.9 AAGTGTGAATTAACGCACTCAT
b3118 tdcA -225 4 TGATGTTATCGCCATAAAATAT
b3118 tdcA -82 4.7 ATTTGTGAGTGGTCGCACATAT
b0452 tesB -138 3.9 AAGTGTGGCACACATCACGCAT
b0001 thrL -83 3.8 TTTATTGACTTAGGTCACTAAA
b4240 treB -101 3.8 AATTGTGATCTTCGCTGCGTTT
b0411 tsx -250 3.7 TTTTGTTACTCTGCTTACATCA
b0411 tsx -129 3.9 AACTGTGAAACGAAACATATTT
b3831 udp -144 5.2 TTATGTGATTTGCATCACTTTT
b3831 udp -92 4.2 CATGGTGATGAGTATCACGAAA
b0480 ushA -174 4 ATTTGTGATTATTACCAGACTA
b3092 uxaC -232 4.5 AAAGGTGAGAGCCATCACAAAT
b3092 uxaC -110 4.4 TTTATTGATCTAACTCACGAAA
b4322 uxuA -271 3.8 TGTTGCGATGAATGTCACATCC
b4322 uxuA -186 4.5 TCTTGTGATGTGGTTAACCAAT
b3565 xylA -224 3.9 ATTTATGACCGAGATCTTACTT
b3565 xylA -134 4.2 TTTTGCGAGCGAGCGCACACTT
b3566 xylF -253 4.2 AAGTGTGCGCTCGCTCGCAAAA
b3566 xylF -163 3.7 AAGTAAGATCTCGGTCATAAAT
b0129 yadI -70 4.1 AGTTTTGACGGCTATCACCCTT
b0162 cdaR -109 3.9 ATCTGTGAACTTCACCACAACT
b0328 yahN -41 3.9 CTTTGTGATCTCTCTCGCACCC
b0453 ybaY -101 4.3 ATGCGTGATGTGTGCCACACTT
b0631 ybeD -94 3.6 AAGTGTAATTTCCGTCCCCATA
b0790 ybhP -56 4.2 TTTTGTGACGCCGACTACACTA
b0791 ybhQ -98 3.9 TAGTGTAGTCGGCGTCACAAAA
b0796 ybiH -123 4.5 TTTTGTGACGCAGCGCATAAAT
b0819 ybiS -116 4.7 AAATGTGATTTCGTACACATCT
b0820 ybiT -124 4.4 AGATGTGTACGAAATCACATTT
b0898 ycaD -29 4.2 AAATTTGAACTTCCTCACGGTT
b1036 ycdZ -52 4 AAATGTGTGCTCGATCTCATTC
b1036 ycdZ -50 3.7 ATGTGTGCTCGATCTCATTCAT
b1111 ycfQ -175 5.3 AGATGTGATCTGGATCACATAC
b1112 ycfR -114 3.7 ATTAATGATTGTTATAAAAAAT
b1112 ycfR -87 4.8 GTATGTGATCCAGATCACATCT
b1188 ycgB -235 4.4 TATGGTGAGCTGGCTCACATCT
b1242 ychE -257 5.1 TTACGTGATCCAAATCAAATTT
b1205 ychH -105 4.5 AATTGTGATCACGCCCGCACAT
b1426 ydcH -96 3.9 AAACACGATCCCGCTCGCATTT
b1422 ydcI -71 3.7 TTTTGCAATCAAGTTATCATAA
b1431 ydcL -216 4 GGATGTGAAATTAATCACAGTA
b1528 sotB -94 4.9 AAACGCGATCCAGATCACAAAT
b1598 ydgD -93 4 TTATCTGATTTTACTCCCACTT
b1654 ydhD -132 3.6 ATATTTGAAATGCAACAAATAG
b1657 ydhP -73 4.3 TTTTGTGATTGCTGTCATGCTT
b1729 tcyP -90 3.9 ATATAAGAGCCAGCTCACAGTT
b1778 msrB -137 5.2 AAATGTGATTTTCATCACGATT
b1795 yeaQ -98 4.2 CTCCGTGATGCTCGTCACAAAT
b1853 hexR -151 3.9 AAATCTGACACTGATCATGTTA
b1915 yecF -260 3.7 AAATGTGACAAAAATTGACTTT
b2063 yegH -43 4.6 AATTGTGACATTTGTCATACAA
b2181 yejG -158 3.7 AAACGTGACCACGCCCGCAGAT
b2295 yfbV -263 3.6 ATTTATGATTAACATCATGCAC
b2295 yfbV -54 4.1 AGTTGTGAATTTGCACAAATTT
b2389 yfeO -109 4.1 AATATCGATCTGGGTCACACAA
b2471 yffB -246 3.8 GTATGTGATACACAGCAACATT
b2597 raiA -81 4.8 TTATGAGATTTTCATCACACAT
b2579 grcA -125 4.2 TTTATTGATTTAAATCAAAGAT
b2735 ygbI -166 3.7 TTGTTTGATATTGTGAATATAA
b2735 ygbI -127 5.2 TATGGTGATCTGATTCACATAA
b2736 ygbJ -90 4.9 TTATGTGAATCAGATCACCATA
b3110 yhaO -228 4.6 TTTTGTGATCTGCCGCAAATAG
b3209 elbB -91 3.7 ATTTGTTACATGAATCAGTTAA
b3209 elbB -69 4 ATGTGTGATGCGTACCATTTTT
b3238 yhcN -60 5.1 TTTTGTGATATGGGTCACGAAA
b3242 yhcR -167 5.4 AAAAGTGATTTAGATCACATAA
b3523 yhjE -155 4.5 TTATGTGAAGCATTTCATAGAA
b3575 yiaK -175 4.1 AAGTGTGCCGTAGTTCACGATC
b3646 yicG -58 4.4 AATCGTGACAATGCGCACAAAT
b3697 yidA -56 4.1 ATTTTTGAGCGGAATCGCGTTA
b3765 yifB -266 4.2 TTTTATGATGCGTTTAATAATT
b3883 yihV -76 3.6 AAAATTGACAGCCGTCACTTTT
b4060 yjcB -149 5.7 AATTGTGATATAGTTCACAAAA
b4190 yjfP -139 3.8 AATTGTTACCTGGTACGCGATT
b4354 cstA2 -231 5.7 ATATGTGATATGAATCACATAT
b4380 yjjI -183 3.9 CACTTCGATACACATCACAATT
b4380 yjjI -130 5 TAATGCGATCTGGTTCAAATAA
b1594 mlc -108 4.1 AAATGTGCTGTTAATCACATGC
b2141 yohJ -68 4.9 TAATGTGATCGGTAGCACGTTT
b2844 yqeF -91 4.6 CTTTGTGATAAAAATCACTTTT
b3279 yrdA -220 3.8 TCCTGTGAAGTGTTTCACGTTG
b3398 igaA -288 3.6 TTGTGCGATATCGGACACGCTT
b3398 igaA -123 3.8 TACTGTGATGTGCTTAATGATG
b4227 ytfQ -98 3.7 AAGTGTGATGTAACGCAATCTG
b1852 zwf -208 3.9 TAACATGATCAGTGTCAGATTT
b1493 gadB -128 3.3 ATTCGCGTAATATCTCACGATA
b1761 gdhA -106 3.5 TTTCTTGCTTACCGTCACATTC
b0116 lpdA -224 3.3 AATTGTTAACAATTTTGTAAAA
b0113 pdhR -156 3.7 AAACGTTATATATGTCAAGTTG
b3588 aldB -94 3.7 ATTCGTGATAGCTGTCGTAAAG
b3666 uhpT -145 4.8 AAGCGTGATGCATCTCACCTTT
b4268 idnK -107 4 TAACGTGATGTGCCTTGTAATT
b4268 idnK -157 4.8 ATTTGTGATGAAGATCACGTCA
b3172 argG -253 4.6 TATAGTGATCCACGCCACATTT
b0034 caiF -134 3.8 AAGCAGGATTTAGCTCACACTT
b4014 aceB -117 3.6 AATTGTTTTTGATTTTGCATTT
b4111 proP -227 5.1 ATGTGTGAAGTTGATCACAAAT
b4123 dcuB -53 3.5 GACTGTGATCTATTCAGCAAAA
b3415 gntT -236 4.3 TAATATGACCAACCTCTCATAA
b3453 ugpB -182 3.6 ATCCGTGCCCCATCTCCCATTT
b3574 yiaJ -47 3.7 GATCGTGAACTACGGCACACTT
b4003 zraS -255 3.6 TTTCGTGTTCCGTTTCATGGTT
b4000 hupA -179 3.4 AAACGTGATTTAACGCCTGATT
b3806 cyaA -172 4 AGGTGTTAAATTGATCACGTTT
b3707 tnaC -94 5 GATTGTGATTCGATTCACATTT
b4193 ulaA -124 3.8 ATTTGCGGGTCGCGTCACATTT
b4193 ulaA -87 3.8 TGTTGTGATTACTTTTGAAAAT
b3356 yhfA -187 4.2 TAATGTGACGTCCTTTGCATAC
b1620 malI -104 3.4 TTTAGTGAGGCATAAATCACAT
b4663 azuC -101 5.7 TTATGTGATTTGTATCACATAA
b1617 uidA -181 4.5 TAATGCGATCTATATCACGCTG
b1617 uidA -140 3.4 TTTTTTGATCGCGGTGTCAGTT
b4663 azuC -71 4.9 TTTTGTGATGGTTGTCATATTA
b1620 malI -102 3.9 TAGTGAGGCATAAATCACATTA
b1620 malI -42 3.9 AAACGTTTTATCTGTCACATAA
b1493 gadB -158 3.3 TATTGTATTGTTTTTCAATGAA
b0108 ppdD -145 3.2 CTTCGTAACGCCTCGCAAATTT
b1040 csgD -201 3.9 TTTAGTTACATGTTTAACACTT
b0440 hupB -213 3.9 AATAGTGACCTCGCGCAAAATG
b1512 lsrR -87 4.1 AACTGTGGTTGCCATCACAGAT
b0330 prpR -107 3.7 ATATGCGTTTCAGTTAACGTTT
b1493 gadB -297 3.6 TTTTATAAATGCGTTCAAAATA
b0331 prpB -153 3.7 AAACGTTAACTGAAACGCATAT
b1241 adhE -241 5 AAATTTGATTTGGATCACGTAA
b1388 paaA -45 3.6 TGTTTTTAATTAATTCACGAAA
b2232 ubiG -236 3.8 AACAATGACCGACATCGCATAA
b0907 serC -155 4.8 TTGTGTGATGCAAGCCACATTT
b1388 paaA -76 3.6 TTGTGTAACTTTCATAAAACAA
b1388 paaA -97 4.3 ATTTGTGATTTTACTTAACTAT
b1387 paaN -109 3.8 AGTTGCTATACAGATCGCATAG
b1387 paaN -175 3.7 AACTGTGACGGATTTCGCACCC
b1387 paaN -261 3.6 TTTCGTGAATTAATTAAAAACA
b1040 csgD -134 3.3 TAGTTTTATATTTTACCCATTT
b2151 galS -95 3.9 TGCTGTGACTCGATTCACGAAG
b2151 galS -146 3.5 GATAACGATCTGGATCACATTC
b2146 yeiT -112 4.8 ATTTGTGAATCTTTTCACAGTT
b1421 trg -201 3.4 TTGCGTGCTGTTTTCCAGAATT
b2009 sbmC -93 3.5 GAGTGCGAGTCTGCTCGCATAA
b2508 guaB -165 4.2 ACATGTGAGCGAGATCAAATTC
b2535 csiE -104 3.5 TTCTGTGACGCTTGCCAACATT
b2741 rpoS -270 4.2 TAATCTGATTATCATCAAACAT
b3076 ebgA -129 4.3 TTTCGTGATCCAGTTAAAGTAA
b3049 glgS -124 3.8 AAGTGTGATCGGGGACAATATA
b3049 glgS -203 3.4 ATCTGTGTTAATAATAACACAG
b3049 glgS -225 3.4 AATAGTTTCCTTGCTTACATTT
b2942 metK -200 3.6 GAATGAGACACGATTCAAAAAA
b3599 mtlA -113 3.3 TTCAGTGCCAGATTTCGCAGTA
Salmonella typhimurium LT2
STM3474 nirB -76 3.4 GAATTTGATTTACATCAATAAG
STM3680 aldB -95 3.7 ATTCGTGATTGCTGTCGTAAAG
STM3466 crp -159 3.1 TACATTGACGTACTGCATGTAT
STM2391 fadL -262 4.8 TTAAGTGACCGAAATCACACTT
STM2391 fadL -240 3.9 AAAAATGATCTAAAACAAAAAT
STM0154 lpdA -153 3.5 GTTTGTGAGGTTATTAGCGAAA
STM3090 metK -200 3.9 CATTGCGACGGCCTTCAAAAAA
STM0158 acnB -157 3.9 TTTTGTAAACAGATTAACACTT
STM0152 aceE -54 3.4 TAATGGGACAGGTTCCAGATAA
STM0152 aceE -79 3 CTTATTAAGCTTTCTCACGAAA
STM4073 lsrR -161 3.6 AACTCTCATCCAGATCACGTTT
STM3685 mtlA -207 4.8 CTTTGTGATCAATATCACATCA
STM3367 aaeR -37 5.3 TTATGTGATCTAAATCACTTTT
STM4275 acs -100 4.1 TTGCGTGATCTGTCGCCCAAAT
STM3217 aer -220 3.6 AAAGGTGAGCCAGGGCAGATTT
STM3217 aer -105 4 AATTGCGATCCAGAGCAATTTT
STM3106 ansB -125 4.3 TTTTGTTATCCATCTCTAAAAA
STM4249 aphA -139 3.7 TGTTGTGATCATCCTCTTTTTT
STM0103 araB -131 3.8 ATATTTGCACAGCGTCACACTT
STM0104 araC -231 4.5 AAGTGTGACGCTGTGCAAATAT
STM3016 araE -271 4 TTTTATGATCTCATTAGCATAG
STM3016 araE -131 4.9 AAGTGTAATATCCATCACATAT
STM4120 argE -66 3.9 TAATGTATTTTTATTCATAATT
STM2670 aroF -71 3.9 TTTTGTGGTATGGTTTAAACAT
STM1347 aroH -106 4.3 AGGTGTGACACGCCTCGCACTT
STM1347 aroH -64 4 TATCGTGATGCCCATCACTTCC
STM4326 aspA -209 4.2 AGCGGTGACCTATTTCACAAAA
STM4326 aspA -159 4.2 TTAAGTGATCCAGATTACGGTA
STM3872 atpI -262 4.6 ATGTGTGATCTGGTGCACGCTT
STM3872 atpI -211 4.1 TTTTGTACGATCGTTCACACTT
STM1834 b1821 -276 3.7 AATTGTTATTTAATTTAACGTT
STM1994 b1963 -70 5.5 AAATGTGATTAATATCACATTA
STM1994 b1963 -34 4.4 TCATATGACTTACATCACAAAA
STM2470 b2462 -168 3.8 AAATGTGATGCACCACGATATT
STM2470 b2462 -103 4.6 CTTAGTGATCTACCTCACCTTT
STM3663 bax -189 4.4 ATTTGCGATAAGCACCACATTT
STM0074 caiT -167 4.5 AAGTGTGACGAAGATAACAGAA
STM2183 cdd -128 4.2 ATTTGCGATACGTCGCGCATTT
STM2183 cdd -78 4.8 CAATGAGATTTAGATCACATAT
STM1312 chbB -250 3.9 TTTTGTGCCTGCCATAACCTTA
STM1312 chbB -203 3.9 AAATGTGAGGGGGGTCATAACG
STM0944 clpS -164 4 AAATTTGAAGCAGTTAACGCTA
STM0944 clpS -104 3.6 AGATGTTAGTTATCTATCAATT
STM4403 cpdB -145 3.7 TTCTGTGAACACTCGCAAAAAA
STM0943 cspD -181 4 TAGCGTTAACTGCTTCAAATTT
STM0629 cspE -114 4.3 TAACGCGATATTTATCACTTTT
STM4398 cycA2 -193 5.1 TTTTGTGAGCTAATTCGCATTA
STM4398 cycA2 -170 3.9 CAAAGTGATATAACACTCATTT
STM0740 cydA -256 3.7 TAAATTGATCGCTGTCGAAAAA
STM4404 cysQ -144 3.9 TTTTTTGCGAGTGTTCACAGAA
STM2062 dacD2 -95 4.8 AAATGTGCCTTGTGTCACATTT
STM1803 dadA -107 4.6 ATATGTGAAGCACGTCACCATA
STM3614 dctA -145 4.1 TTGTGCGAGCCAGCTCAAACTT
STM3280.S deaD -154 3.9 CTTTTTGATTGCCATCACCTTC
STM3280.S deaD -99 4.4 TACTTTGAGCCGGTTCACACTT
STM4567 deoC -133 4.9 TAATTTGATTCAGATCTCATTA
STM4567 deoC -80 4.2 AACTGTGATGTATATCGAAGTG
STM3830 dgoR -154 4.2 TTTTGTGATCTAAATTGTAGTA
STM3800 dsdC -142 3.8 TGATGTAAATTGAATCAACTAT
STM3800 dsdC -124 4.5 CTATGTGATTTCCATCTAATAT
STM3800 dsdC -94 4.2 TTTTGCGATATGGTTCATTTTA
STM3801 dsdX -153 4 TAAAATGAACCATATCGCAAAA
STM3801 dsdX -123 4.2 ATATTAGATGGAAATCACATAG
STM3070 epd -213 5 AAATGTGATGCAGGTCAGATAA
STM1818 fadD -131 3.7 AATAGTGACGCGCTTCGCAACC
STM3219 fadH -113 4.3 TTTTTTGAATCCCATCACAATC
STM1805 fadR -21 3.8 CTGTGTAATGGAAATCTCACTA
STM0529 fdrA -120 4.4 TGATGTGACGTTAATCACTCTA
STM0075 fixA -281 3.8 ATTTTTGCTTTATTTATCAATT
STM0075 fixA -196 3.7 AATATTGAAAATTTTCATATTT
STM0075 fixA -157 4 ATTGGTGAGGTGCGTAACACTA
STM1925 flhD -285 5.8 ATATGTGATCTGCATCACATAT
STM0974 focA -78 4.4 AGATATGATCTATATCAAATTC
STM2206 fruB -177 4.6 AAATGTGCTTCACCTCAAAAAA
STM4112 frwC -221 4.1 AAATGTAATGTAGCGCAAAAAG
STM4112 frwC -202 4 AAGTGCGAGTTGTCTCACAACT
STM4112 frwC -147 4.3 AGTTATGAAGCGGATCGCATTT
STM0493 fsr -100 3.8 AATTGAGACTTCCTTCAAACAC
STM2974 fucA -157 4.8 TTAATTGATGTGAATCACAAAA
STM2975 fucP -207 4.7 TAAAGTGATGATAATCACAGAA
STM2975 fucP -167 4.9 AAATGTGACCGCCATCATATTA
STM4327 fxsA -203 4.1 TACCGTAATCTGGATCACTTAA
STM4327 fxsA -153 4.1 TTTTGTGAAATAGGTCACCGCT
STM0776 galE2 -78 3.7 TAATTTATTACATGTCACACTT
STM3091 galP -83 4.6 CATTGTGATTAGCCTCACATCT
STM1290 gapA -226 4.8 AATCGTGACTGATGTCACATTA
STM3250 garD -153 4.3 TGCGGTGATCTGGATCACATTC
STM2403 glk -116 3.9 TTCTGTGATGAAGATCTATATT
STM4007 glnA -272 4.2 CTTTGTGATCGCTTTCACGGAG
STM4007 glnA -114 3.8 CAATGTGAAAGTTGGCACAGAT
STM2284 glpA -163 5 TAATGTGAATTACAGCACATAT
STM3526 glpD -116 4.4 TAATGTTATACATATCACTCTA
STM3525 glpE -104 4.7 TAGAGTGATATGTATAACATTA
STM4087 glpF -147 3.9 TTTATTGACGCAGTACACACAT
STM2283 glpT -220 3.6 ATGTTTGATTTCGCGCATAATC
STM2283 glpT -180 4.2 AAACGTGATTTCGTGCGCCTTT
STM2283 glpT -131 5.2 ATATGTGCTGTAATTCACATTA
STM0665 glnH2 -87 4 AAATGTTAACAAACACACATAA
STM3542 gntK -132 4.4 AACTTTGAAGTAGCTCACACTT
STM3330 gltB -288 3.7 ATCTGTGCTACAGCACACTTTT
STM3938 hemC -219 4.2 AAACGTGATCAATTTAACACCT
STM1751 hns -229 4.3 AAATGTGACCTGACTCCTAAAT
STM1751 hns -163 3.8 TTTTGTGCGGTGCCTCAAGGAA
STM1101 hpaG -122 4.7 TATTGTTAATCACATCACAAAT
STM1100 hpaR -174 5.2 ATTTGTGATGTGATTAACAATA
STM0170 hpt -147 5.3 ATGTGTGATCGTCATCACAAAA
STM0790 hutU -180 4.3 AAACGTGATTGCTGACACAATA
STM4484 idnD -81 4.3 CAGCGTGACATAAGTCACAAAT
STM1377 lpp -56 3.6 TTGTGTAATACTTGTAACGCTA
STM4074 lsrA -185 4 AACCGTGATTAACGCCACAAAA
STM4074 lsrA -116 3.8 AAACGTGATCTGGATGAGAGTT
STM0472 maa -97 4.7 AACAGTGATATAGATCACATAG
STM2472 maeB -240 3.8 ATGAGTGTGTTGATTCACACTT
STM4229 malE -192 4.3 TTTCGTGATGCCGCCCGCAAAA
STM4229 malE -160 3.6 TTTTGTGTGCGCCAGCACGCAT
STM4229 malE -158 3.8 TTGTGTGCGCCAGCACGCATTA
STM4229 malE -129 4.3 TTATGCAACACAGATCACATAA
STM4230 malK -254 4.7 TTATGTGATCTGTGTTGCATAA
STM4230 malK -225 3.6 TAATGCGTGCTGGCGCACACAA
STM4230 malK -223 3.8 ATGCGTGCTGGCGCACACAAAA
STM3664 malS -148 4.5 AAATGTGGTGCTTATCGCAAAT
STM3515 malT -143 4.3 AATTGTGACAGAGTGCAAATTC
STM2988 mltA -104 3.7 ATTTTTAAACGAATTTACATAA
STM2988 mltA -85 4.7 TAATGAGATCGCGATCGCATTT
STM2831 mltB -182 4.4 AAGTGTTATTGTGATCGCAAAA
STM0684 nagB -205 3.7 AAAATTAATTCGCCTCGCAAAT
STM0684 nagB -171 4.7 TTTTGTGATTATAATCACTAAA
STM0685 nagE -177 4.8 TTTAGTGATTATAATCACAAAA
STM3339 nanA -113 4.4 TTTAGTGAAGCAGATCGCACTA
STM1211 ndh -154 4.1 AAACTTGATGCACATCAATTTT
STM0039 nhaA -97 3.7 AAACGAGCTATTCATCATATAT
STM2409 nupC -133 3.7 AAGTGTATTACAGATCACTAAT
STM2409 nupC -84 3.8 TAGTGTGTGTTGGATCTCGTTT
STM3113 nupG -166 3.9 AAGTGTTAACTCCGTCACCCTT
STM3113 nupG -116 3.6 ATATTTGTCACAGGTAACAAAA
STM3113 nupG -50 3.6 AAATGTGCCTTTTAAAACATTC
STM1070 ompA -188 4.3 ATGTCTGACGGAGTTCACACTT
STM0999 ompF -245 4.5 AAGTTTGACGTTGTTCACAAAG
STM1732 ompW -82 4.2 AAATGTGATCTGTATTAGATCA
STM4561 osmY -268 4.4 AATTGTGATCTATATTTAACAA
STM3500 pck -241 4 GAATGCGATTACAGTCACATTA
STM3500 pck -107 3.9 AATCGTGATTTTGTCCAGATAC
STM1227 pepT -73 3.6 AAAAGTGACCTGACGCAATATT
STM4221 pgi -61 3.7 TTCTGTGACTGGCGTTACAATC
STM3472 ppiA -214 4.3 TTTTGTGATGCATTTAAATAAT
STM3472 ppiA -161 5.1 TAATGTGATGTTTGTCACATCA
STM1203 ptsG -155 4.4 AAACGTGATAGCCGTCAAACAA
STM2431 ptsH -209 4.4 TTTTATGATTTGGTTCAAATCT
STM1125 putP -204 3.6 AAATGTGAGAGAGTGCAACCTG
STM1982 rcsA -201 4 TGTTTTTACTTCACTCACATAA
STM4047 rhaB -247 3.9 AAGGGTTATCGGCCTCACCTTA
STM4047 rhaB -127 4.1 AACTGTGAACGCTATCACGTTC
STM4048 rhaS -182 4.3 GAACGTGATAGCGTTCACAGTT
STM4048 rhaS -147 4 CGGTGTGATGTCGTCCGCATTT
STM4048 rhaS -62 3.8 TAAGGTGAGGCCGATAACCCTT
STM4050 rhaT -293 3.6 TTATGTGACCTCACGCAGCGTT
STM4050 rhaT -149 3.9 AAACGTGAAGTTAATCACTTCA
STM0616 rnk -141 3.8 GAATGTGAACTAAATCACTTCA
STM2970 sdaC -176 4.2 ATTTGAGATCGGGATCACTGAT
STM3062 serA -217 4.5 TTTGGTGACATGTATCACGTTT
STM2207 setB -213 4.6 TTTTTTGAGGTGAAGCACATTT
STM2214 spr -128 3.7 ATTTGTGCGTTCCGCCACAGAT
STM2832 srlA -93 4.3 TTTTGCGATCACAATAACACTT
STM0149 araT -127 3.8 GGGTGTTATCTGCCTCACAGTT
STM2345 CKO_00488 -192 4 AGCTGCGATCGTTATCACAAAG
STM2345 CKO_00488 -143 4.6 AATTGTGATAGCGCTATCAAAT
STM4440 CKO_03591 -229 4.5 AACTGTAATACCCATCACACTT
STM4440 CKO_03591 -162 3.8 TGCCGCGATAGATCTCACACTT
STM4440 CKO_03591 -111 4.1 TTCTGTGGCGCAGATCACCTAT
STM2473 talA -53 3.7 AAGTGTGAATCAACACACTCAT
STM3245 tdcA -188 3.9 TTTTTTGATTGAAATCAGGCTA
STM3245 tdcA -83 4.7 ATTTGTGAGTGGTCGCACATAA
STM0001 thrL -103 4.2 GAATGTGATCAATTTAAAAATT
STM4454 treB -108 3.6 ATTTGTGATCGTCGCTGCGTTT
STM0413 tsx -129 4 ATATGTGAAACAAGACATATTT
STM3968 udp -144 5.1 TATTGTGATGAACATCACTTTT
STM3968 udp -92 4.1 CATAGTGATGGCTGTCACGAAA
STM3135 uxuA -205 4.3 AAAATTGACACAGATCAAATAA
STM3135 uxuA -155 4.6 ATTTGTGATTTGGTTAGCCAAT
STM3661 xylA -260 3.9 TTATGCGAAATTCATCACAGCA
STM3661 xylA -133 4.4 TTTTGAGAGCCAGAGCACATTT
STM3662 xylR -251 4.8 AAATGTGCTCTGGCTCTCAAAA
STM3662 xylR -124 4.5 TGCTGTGATGAATTTCGCATAA
STM0178 yadI -228 3.6 AAATATGAAATATTTATAATAT
STM0178 yadI -67 3.8 TAGTGTGTTGTCGGCCAAAAAA
STM0365 yahN -82 4.4 CTTTGTGATCTCACTCGCAATC
STM0465 ybaY -100 3.9 ATGAGTGACATGTGCCACACTT
STM0636 ybeD -93 4.2 AAGTGTGATTTTCGTCCCCATA
STM0636 ybeD -35 3.9 AGTTGTTATTTTTTTTACGTAA
STM0813 ybhP -56 4 TTTTGTGACGACGACTACACTA
STM0814 ybhQ -98 3.8 TAGTGTAGTCGTCGTCACAAAA
STM0819 ybiH -124 4.7 TTTTGTGATGCGGCGCATAAAT
STM0837 ybiS -116 4.4 AAACGTGATTTCGTACACATCT
STM0838 ybiT -124 4 AGATGTGTACGAAATCACGTTT
STM0968 ycaD -29 4.2 AAATTTGAACTTCCTCACGGTT
STM0983 ycaI -120 4.1 TTTTTTGCTGCGTCTTACATTT
STM1213 ycfQ -175 4.7 AGATGTGATCTACATCACACGT
STM1214 ycfR -88 4.7 ACGTGTGATGTAGATCACATCT
STM1804.S ycgB -243 4.9 TATGGTGACGTGCTTCACATAT
STM1748 ychE -256 4.8 TTGTGTGATCTAAATCAAGATT
STM1782 ychH -105 4.4 ATTTGTGATCGCACCCGCACTT
STM1625 ydcI -71 3.6 TTTTGCTATCAGGTTATCAAAA
STM1607 ydcL -95 4.2 AATTGTGCTGTCGTTACCATTT
STM1522 sotB -94 4.5 AAATGAGAAGCAGGTCACAAAA
STM1484 ydgD -93 4 TTATCTGATTTTACTCCCACTT
STM1320 tcyP -91 3.9 ATATAAGAGCCAGCTCACAGTT
STM1291 msrB -107 4.7 TAATGTGACATCAGTCACGATT
STM2119 yegH -42 4.5 AATTGTGACAATTGTCATATTA
STM2404 yfeO -109 3.9 AATATAGATCTTCATCACAGAA
STM2424 yfeR -37 3.6 AAAATTGATTTATTGCATCTAT
STM2482 yffB -282 4 TTATGTGACTTACTGCAATATT
STM2919 ygbI -128 4 TGCGGTGAGTTGTTTCACAAAA
STM2919 ygbI -87 3.6 TTTTGTGAAGGCAATCCTCATA
STM2918 ygbJ -90 4 TTTTGTGAAACAACTCACCGCA
STM3239 yhaO -230 4.5 TGTTGTGATACGCGTCAAATAG
STM3327 elbB -91 3.9 ATTTGTTACATGAATCATTTAA
STM3327 elbB -69 3.6 ATGTGTGAAGCGTAGCATTTTA
STM3361 yhcN -60 5 TTTTGTGATGAGGGTCACGAAA
STM3366 yhcR -166 5.4 AAAAGTGATTTAGATCACATAA
STM3473 yhfC -137 5 TGATGTGACAAACATCACATTA
STM3473 yhfC -84 3.8 ATTATTTAAATGCATCACAAAA
STM3609 yhjE -154 4.2 TTATGTGAAGCATTTCATAGAC
STM3668 yiaK -187 4.5 AAGTGTGTTGCAGTTCACGATA
STM3738 yicG -210 3.7 TTAAATTATCTAAGTCAAAATA
STM3738 yicG -147 3.8 TTTATTGATATTTATAATAAAT
STM3738 yicG -58 4.9 AATCGTGATACAGCGCACAAAT
STM3831 yidA -56 4.1 TTTTTTGAGCGGAATCGCGTTA
STM4024.S yihV -69 3.6 AAAATTGACAGCCGTCACTTTT
STM4263 yjcB -149 5.7 TTTTGTGATATAGTTCACAAAA
STM4380 yjfP -98 3.9 AAGTGTAACCCAGTTCTCAAAC
STM4532 cstA2 -229 5.4 TATCGTGATCTCAATCACATAA
STM4566 yjjI -183 3.7 CACTTCGATATACATCACAGTT
STM4566 yjjI -130 4.8 TAATGAGATCTGAATCAAATTA
STM4600 yjtD -97 3.6 TTCAGTGATATCAGTTAAAATT
STM1488 mlc -65 3.8 AGTATTGAAGTGTTTCACCATA
STM2169 yohC -82 4 TATTTTGCCATTGTTCATAAAA
STM2181 yohJ -68 4.6 TGATGTGATCGGTAGCACGTTT
STM3019 yqeF -92 4.5 CTTTGTGATAAAACTCACTTTT
STM3399 yrdA -222 4.3 TTGTGTGAAGTGATTCACATCC
STM3495 igaA -238 3.6 TTATGTAACGTAATAAAAATTA
STM0151 pdhR -120 3.2 TTTACTGATTTCAATCAAAACC
STM0151 pdhR -157 3.5 AAACATGATTTCTGTAAAATTG
STM3685 mtlA -163 5.4 TTATGTGACGCAAATCACATAA
STM3787 uhpT -150 4.7 AAGCGTGATACACCTCACCTTT
STM4485 idnK -157 4.4 ATTTGTGACTTATGTCACGCTG
STM4485 idnK -107 3.9 TAACGTGATGTGCCTTAGAGTT
STM4121 argC -44 3.5 AATTATGAATAAAAATACATTA
STM0068 caiF -134 3.8 AAGCACGATATTGCTCACACTA
STM4183 aceB -168 3.3 TTAATTTATATTGTTATCAATA
STM4301 dcuB -53 3.5 GGCTGTGATCCATTTATCAAAA
STM4290 proP -235 5.2 ATGTGTGAAGTTGATCACATAT
STM3512 gntT -37 3.2 TGACGTTACCCATAACAAAGTA
STM3512 gntT -236 4.1 TAACATGACCTGTGTCTCATAA
STM3512 gntT -178 3.8 ATATGTTACCCGTATCATTCTT
STM3667 yiaJ -64 4.4 TATCGTGAACTGCAACACACTT
STM3557 ugpB -184 3.5 ATCCGTGCCGTAGCTCCCACTT
STM3939 cyaA -164 4 AGGTGTTAAATTGATCACGTTT
STM4383.S ulaA -122 3.9 ATTTGCGCGCTACGTCACAGTT
STM4383.S ulaA -85 3.8 TGTTGTGATTACTTTTGAAAAT
STM1749 adhE -242 4.9 AATCTTGATTTAGATCACACAA
STM2193 folE -101 4 TTATGTGCGCTACCTCACGCAC
STM0367 prpR -89 3.5 TTTCATGAAACGAATCACCCTG
STM1142 csgD -202 3.4 TTTGGTTACAAGTTTAACACTT
STM0451 hupB -213 4 AATAGTGACCTCGCGCAAATAG
STM4073 lsrR -92 4 TTTTGTGGCGTTAATCACGGTT
STM0977 serC -142 4.2 TTGTGTGACGCATGCCGCATTT
STM0368 prpB -197 3.5 CAGGGTGATTCGTTTCATGAAA
STM1299 gdhA -55 3.6 TATTCTGATAAAACGCAAATAC
STM1299 gdhA -107 3.6 TTTCTTGCTTACCGTCACATTG
STM2191 galS -38 3.3 ATTTGTGAGCATTTTTGAACTC
STM2191 galS -103 3.5 CCCTGTGATGTTTCTCACGCAG
STM2191 galS -154 3.5 GATAACGATCTGGATCACATTC
STM2186 yeiT -121 4.9 TTTTGTGAATTCTTTCACAGAA
STM2186 yeiT -168 4.1 TATTATGATATAAGGAACAAAT
STM2186 yeiT -201 3.5 ATTTATTATCCCTTTAAAATTG
STM2061 sbmC -102 4.1 GATTGCGAGGTTGCTCACAAAA
STM2511 guaB -164 4.2 ACATGTGAGCGGGATCAAATTC
STM2553 csiE -106 3.8 TTCTGTGACACTCCTCAGCATT
STM2924 rpoS -270 3.7 TAATCTTATTATCATCAAACAT
STM3197 glgS -117 4.2 TATTGTGATTTTGCGCATTAAA
STM3197 glgS -178 4.2 TCATGTGACCCATATCTCCTTA
STM3197 glgS -222 3.3 TCGCGTGATAATTTTCATGCTT
STM3465 yhfA -188 3.9 TAATGTGATGTCCTCTGCATAC
Citrobacter koseri ATCC BAA-895
CKO_04789 nirB -76 3.4 GAATTTGATTTACATCAATAAG
CKO_04777 crp -160 3.1 TACATTGACGTACTGCATGTAT
CKO_00446 fadL -263 4.8 ATAAGTGACCGAAATCACACTT
CKO_00446 fadL -241 3.9 AAAAATGATCTAAAACAAAAAT
CKO_04651 aaeR -37 5.3 ATATGTGATCTAAATCACTTTT
CKO_03816 acs -101 4.3 TTGCGTGATCTGCCGCGCAAAT
CKO_04485 aer -290 3.9 ATTGGTGATGTTTTGCGCAATG
CKO_04485 aer -105 5 AATTGCGATCTAAATCAAATTT
CKO_01448 aldA -137 4.7 TTTTATGAAGCACATCACAAAA
CKO_01448 aldA -91 3.9 ACATGTGATTGTTATTACTTAA
CKO_04332 ansB -125 3.6 TTTTGATATCCATCTCTAAAAA
CKO_03845 aphA -255 3.9 TATTGTGAATGCGTGTACAGAA
CKO_03845 aphA -224 3.7 GTGTGTGTGGTTTATCACACAT
CKO_03319 araB -132 3.9 ATATTTGCACGGCGTCACACTT
CKO_03318 araC -230 4.4 AAGTGTGACGCCGTGCAAATAT
CKO_01050 araF -164 4 CGGTGTGATGCCGCTCTCCTAT
CKO_03037 argE -27 4.3 TAATGTATTTTTATTCACAAAT
CKO_01728 aroH -115 4.3 AGGTGTGAAACGCCTCGCATTT
CKO_01728 aroH -64 4.3 TATTGTGATGCCCATCACTTCC
CKO_04070 ascF -179 4.4 ACAAGTGATCATTCTCACAATT
CKO_03696 aspA -54 4.2 AGCGGTGACCTATTTCACAAAA
CKO_00079 atpI -262 4.7 ATATGTGATCCGAAGCACGCTT
CKO_00980 yedJ -168 3.8 TTTTGTGAATGTTTTATCGTAA
CKO_00333 b2462 -103 4.6 CTTAGTGATCTACTTCACCTTT
CKO_00646 cdd -128 4.3 ATTTGCGATGCGTCGCGCATTT
CKO_00646 cdd -78 4.8 CAATGAGATTTGGATCACATAT
CKO_01676 cfa -81 4.1 TTCCGTGAGATTTCTCACAAAG
CKO_01763 chbB -188 4.1 AAATGTGAGAGGGGTCATAACA
CKO_05006 CKO_05006 -95 4.4 CTTCGTGATGGTGATCATAATT
CKO_02199 clpS -164 4 AAATTTGAAGCAGTTAACGCTA
CKO_02199 clpS -135 4.2 TAATGTGACAGATGTCGCGGAT
CKO_03616 cpdB -25 4.2 TTTTGTGTTTCAGATCTAAAAA
CKO_02200 cspD -210 3.9 ATCCGCGACATCTGTCACATTA
CKO_02200 cspD -181 4 TAGCGTTAACTGCTTCAAATTT
CKO_02534 cspE -21 4.3 TAACGCGATATTTATCACTTTT
CKO_02563 cstA2 -134 4.3 TGAAGTGATCCAGTTAACAATG
CKO_03624 cycA2 -199 4.4 TTTTGTGAGCTAATTCGCGTTG
CKO_03615 cysQ -178 4.1 TTTTTAGATCTGAAACACAAAA
CKO_03060 cytR -129 3.8 AAATTAAATATCCATCACACTT
CKO_01193 dadA -107 4.5 AGATGTGAGGTGCGTCACCATA
CKO_04970 dctA -145 4 TTGTGCGAGCCAGCTCAAAGTT
CKO_04559 deaD -103 3.9 CTTTTTGATTGCCATCACCTTC
CKO_04559 deaD -48 4.4 TACTTTGAGCCGGTTCACACTT
CKO_03410 deoC -134 4.2 TTATTTGAAGTGGATCTCGTTA
CKO_03410 deoC -81 4.2 AACTGTGATGTATATCGAAGTG
CKO_04994 dppA -121 3.8 TTATGTGAACGGAATCCCCATC
CKO_00019 dsdC -32 3.9 AAGGGTGATTTGCATCCAATAA
CKO_00020 dsdX -124 4 TTATTGGATGCAAATCACCCTT
CKO_04672 dusB -212 3.7 AAATGAGAAGTTACGCAAAATT
CKO_04297 epd -213 4.8 AAGTGTGATGCAGGTCAGATAA
CKO_01286 CKO_01286 -122 3.7 TTTTTTGATCAAAATCAGCATC
CKO_01286 CKO_01286 -66 4.4 AAATGTGAACAACATCACGCAG
CKO_04495 exuT -250 5.2 ATTTGTGATGTCACTCACCTTT
CKO_04487 fadH -113 4.3 TTTTTTGAATCCCATCACAATC
CKO_03341 fixA -179 4 ATTGGTGATCCATCAAACAATA
CKO_03341 fixA -122 4.4 ATTAGTGAGATGCTTAACAATA
CKO_01056 flhD -283 5.9 TTATGTGATCTGGATCACATAT
CKO_02167 focA -198 3.6 TATTTTTATTTGGATAATCAAA
CKO_02167 focA -120 4.4 AGATATGATCTATATCAAATTC
CKO_00613 fruB -50 4.1 AAGTGTGCTTTATCTCTAAATT
CKO_03045 frwC -202 3.9 AATTGCGAGACACTTCACAAGT
CKO_03045 frwC -147 4.3 AGTTATGAGGCGGATCGCATTT
CKO_02670 fsr -102 3.8 AATTGAGACTTCCTTCAAACAC
CKO_04159 fucA -144 4.7 TTAATTGATGCGTATCACAAAA
CKO_04160 fucP -219 5 TAAAGTGATGATAATCACATAA
CKO_04160 fucP -179 4.8 AAATGTGACCACCATCATATTA
CKO_03695 fxsA -156 4.1 TTTTGTGAAATAGGTCACCGCT
CKO_02376 galE2 -36 3.7 TAATATATTCCATGTCACACTT
CKO_04318 galP -83 5.3 TAACGTGATTCGAATCACATAT
CKO_01800 gapA -226 5 AATCGTGATCGGAATCACGTTT
CKO_04527 garD -54 4 AGTTGTTCTCTTTAACACATTT
CKO_02295 CKO_02295 -218 3.9 TTTTGTTATCTCATTGAAAATT
CKO_02295 CKO_02295 -104 4.1 TTTTGTGCAAGTTTTCTCATTA
CKO_00412 glk -116 4.5 TTATGTGATGCAGATCGATATT
CKO_03140 glnA -250 4.2 CTTTGTGATCGCTTTCACGGAG
CKO_00536 glpA -163 4.7 TAATGTGAATTACAGCACAGAT
CKO_04845 glpD -116 4.5 TAATGTTATATGTATCACTCTA
CKO_04844 glpE -108 4.6 TAGAGTGATACATATAACATTA
CKO_00537 glpT -221 3.6 TTGTTTGATTTCGCGCATAATC
CKO_00537 glpT -181 4 AAACGTGATTTCGTGCGCTTTT
CKO_00537 glpT -132 4.8 ATCTGTGCTGTAATTCACATTA
CKO_02507 glnH2 -67 3.7 AAATGTTAACAAACACGCATAA
CKO_04856 gntK -172 4.8 AAATTTGAAGTAGCTCACACTT
CKO_00147 hemC -220 4.2 AAACGTGATCAATTTAACACCT
CKO_01316 hns -164 4 TTTTGTGCGGTTCTTCAAGAAA
CKO_03242 hpt -135 5.3 AAGTGTGATCGTCATCACAAAA
CKO_02357 hutU -123 3.8 AAGCGTGATTGCTGACGCAATA
CKO_02795 idnD -140 5.4 TAATGTGACATGTTTCACAAAT
CKO_02295 CKO_02295 -218 3.9 TTTTGTTATCTCATTGAAAATT
CKO_02295 CKO_02295 -104 4.1 TTTTGTGCAAGTTTTCTCATTA
CKO_02825 lacZ -110 4.4 TTGTGTGAGTCAGTTCACTCAT
CKO_01710 lpp -56 3.6 TTGTGTAATACTTGTAACGCTA
CKO_02692 maa -101 4.6 TCTCGTGATTTAGATCACATCA
CKO_03881 malE -193 3.7 TTTCGTGATGTCACCTGCAAAA
CKO_03881 malE -159 3.9 TTATGTGCGCCAACACGCATTA
CKO_03881 malE -130 4.3 TTATGCAACACAGATCACATAA
CKO_03880 malK -254 4.7 TTATGTGATCTGTGTTGCATAA
CKO_03880 malK -225 3.7 TAATGCGTGTTGGCGCACATAA
CKO_04838 malP -139 4 TTAAGTGGCGGCGATCACACTT
CKO_04840 malT -142 4.3 AATTGTGACAGAGTGCAAATTC
CKO_00641 mglB -270 4.7 ATATGTGAGTAAATTCACAGTA
CKO_04178 mltA -164 3.8 TTTTTTCACCCGGATCACGAAA
CKO_04055 mltB -184 4.5 AAGTGTTATTTTGATCTCAAAA
CKO_02486 nagB -218 3.8 AAAATTAATTCGTATCGCAAAT
CKO_02486 nagB -184 5.2 TTTTGTGATTTGAATCACCAAA
CKO_02485 nagE -181 4.9 TTTGGTGATTCAAATCACAAAA
CKO_02485 nagE -147 3.6 ATTTGCGATACGAATTAATTTT
CKO_04629 nanA -116 4.2 TTTAGTGAAGTAGATCGCACTC
CKO_04820 nudE -54 4.1 AACCGTGCTGTATATCGCACAA
CKO_00402 nupC -133 3.7 AAACGTATTCCAGATCACTAAT
CKO_00402 nupC -114 4 AATTTTGAATCTCATCACAGCT
CKO_00402 nupC -84 3.7 TAGTGTGTGTTTGATCTCGTTT
CKO_04339 nupG -166 3.9 AAGTGTTAACTCCATCACTCTT
CKO_04339 nupG -116 3.6 ATATTTGTCACAGGTAACAAAA
CKO_04339 nupG -50 3.6 AAATGTGCCTTTTAAAACATTC
CKO_02111 ompA -164 4 ATGCCTGACGGAGTTCACACTT
CKO_01333 ompW -82 3.9 TAATGTGATCTGTATTGGATCA
CKO_03416 osmY -194 3.8 GATTGTGATCTATATTTAACAA
CKO_04825 pck -107 3.9 AATCGTGATTTTGTCCAGATAC
CKO_01926 pepT -73 3.6 AAAAGTGACCTGACGCAATATT
CKO_03893 pgi -61 4.1 TTTTGTGACTGGCGTTACAATC
CKO_00166 pldB -60 3.8 TATTGTGTCAGGCATCATAAAG
CKO_04785 ppiA -215 3.7 TTTAGTGATGTATTTAAATGTT
CKO_04785 ppiA -162 5.2 TAACGTGACATTGATCACATTA
CKO_01957 ptsG -229 4.4 AAACGTGATAGCCGTCAAACAA
CKO_02041 putP -80 3.6 AAATGTGAGAGAGTGCAACCTG
CKO_00992 rcsA -200 4.1 TGTTTTTACCTTACTCACATAA
CKO_03100 rhaB -182 4.5 AATTGTGAACGCTATCACGTTC
CKO_03099 rhaS -194 4.5 GAACGTGATAGCGTTCACAATT
CKO_03099 rhaS -34 4.3 ATTTCTGACATGTTTCTCATAT
CKO_03094 rhaT -148 4.1 ATATGTGAGCCAAATCACCCGT
CKO_02549 rnk -141 3.9 GAATGTGAGCTAAATCACTTCA
CKO_04152 sdaC -176 4.1 ATTTGGGATCGCGATCACTGAT
CKO_00612 setB -212 3.7 AATTTAGAGATAAAGCACACTT
CKO_03093 sodA -150 4.4 ACGGGTGATTTGGCTCACATAT
CKO_04056 srlA -93 4.3 TTTTGAGATCAAAATAACACTT
CKO_00488 CKO_00488 -192 4.6 ATCTGTGATCATATTCACAAAG
CKO_00488 CKO_00488 -143 4.5 ATATGTGATAGCGCTATCAAAA
CKO_04518 tdcA -225 4.3 ATATGTTATCGCCATAAAATAT
CKO_04518 tdcA -187 3.9 TTTTTTGACAAAAATCATGATA
CKO_04518 tdcA -82 4.6 ATTTGTGAGTAGTCGCACATAA
CKO_02706 tesB -135 3.9 AAGTGTGGCATATCTCACTTAT
CKO_03385 thrA -249 4.1 GAATGTGATCAAATTAAAAATT
CKO_03571 treB -156 3.8 ATTTGTGATCTTCGCTGCGTTT
CKO_02750 tsx -131 3.7 ATCTGTGAAACAAGACATATTT
CKO_00173 udp -143 5.2 TTATGTGATGTAAATCACTATT
CKO_00173 udp -91 3.9 CATGGTGATGAGCGTCACGAAA
CKO_04494 uxaC -169 4.6 AAAGGTGAGTGACATCACAAAT
CKO_04494 uxaC -47 4.3 TTTATTGATCCAACTCACGAAA
CKO_00609 uxuA -115 3.9 GATTGTGAGCTGGATCAATCAA
CKO_05021 xylA -214 4.1 AATTATGACCGAGATCGTACTT
CKO_05021 xylA -122 4.2 TTTTGCGAGGCGGCGCACACTT
CKO_05022 xylF -254 4.1 AAGTGTGCGCCGCCTCGCAAAA
CKO_05022 xylF -162 3.8 AAGTACGATCTCGGTCATAATT
CKO_03205 cdaR -57 3.7 TTCTGTGAGGCCTCCCACAACT
CKO_02833 yahN -78 4.2 ATTTGTGATCTTTCTCTCACCC
CKO_02705 ybaY -102 4 ATAAGTGAGATATGCCACACTT
CKO_02527 ybeD -91 4.4 AAGTGTGATTTCCATCCCCATA
CKO_02337 ybhP -56 4 TTTTGTGACGACGACTACACTA
CKO_02336 ybhQ -153 3.8 TAGTGTAGTCGTCGTCACAAAA
CKO_02331 ybiH -124 4.5 TTTTGTGACATACCGCATAAAT
CKO_02299 ybiS -202 3.8 ATATGTGACAAACCGCTTATTA
CKO_02299 ybiS -116 4.7 AAATGTGATTTCGTACACATCT
CKO_02298 ybiT -148 4.4 AGATGTGTACGAAATCACATTT
CKO_02171 ycaD -29 4.2 AAATTTGAACTTCCTCACGGTT
CKO_02033 ycdZ -40 3.9 AAATGTGTGCGTGATCTCATTC
CKO_01943 ycfQ -227 4.4 AGATGTGATCCAGGTCACACGT
CKO_01942 ycfR -113 3.8 TATAATGATCGTTATAAAAAAA
CKO_01942 ycfR -86 4.5 ACGTGTGACCTGGATCACATCT
CKO_01319 ychE -167 5 TTGCGTGATCCAGATCAAATTT
CKO_01260 ychH -104 4.1 AATTGTGATCGCCCACGCACTC
CKO_01463 ydcH -96 4 AAACTCGATCCCGTTCGCATTA
CKO_01457 ydcI -71 3.6 TTTTGCTATCAGGTTATCAAAA
CKO_01468 ydcL -96 4.1 ATTTGTGCTGGCGATACCATTT
CKO_01548 sotB -94 4.8 TAATGAGACATACATCACAAAA
CKO_01604 ydgD -95 4 TTATCTGATTTTACTCCCACTT
CKO_01669 ydhP -71 4.4 TTTTGTGATTGATGTCATGCTT
CKO_01755 tcyP -90 3.7 ATATAAGAGGTCGGTCACAGTT
CKO_01799 msrB -107 4.9 AAACGTGATTCCGATCACGATT
CKO_01818 yeaQ -97 4.9 AAAAGTGACATTTATCACAAAT
CKO_00719 yegH -42 4.5 AATTGTGACAACTGTCATATAA
CKO_00411 yfeO -134 4.4 AATATCGATCTGCATCACATAA
CKO_00385 yfeR -37 3.6 AAAATTGATTTATTGCATCTAT
CKO_00317 yffB -276 4 TTATGTGACTTACTGCAATATT
CKO_03918 raiA -40 5.2 TAATGTGATTTAAATCACGCTT
CKO_00205 grcA -127 4 TTTGTTGATTTAAATCAAAGAA
CKO_04511 yhaO -180 4.7 TGTTGTGATCTGCTTCAAGAAT
CKO_04612 elbB -92 3.7 TTTTGTTACATGAATCAGTTAA
CKO_04612 elbB -70 3.6 ATGTGTGAAGCGCAGCATTTTA
CKO_04644 yhcN -60 5 TTTTGTGATGAGGGTCACGAAA
CKO_04650 yhcR -168 5.4 AAAAGTGATTTAGATCACATAT
CKO_04963 yhjE -155 4 TTGTGTGAAGCATTTCATAGAC
CKO_04963 yhjE -94 3.7 TTATTTGAGCGAAATCCCGCTT
CKO_05033 yiaK -177 4.1 AAGTGTGTTTCAGTTCACGATC
CKO_05103 yicG -58 4.7 AATCGTGATATTACGCACAAAT
CKO_00044 yidA -56 4.1 TTTTTTGAGCGGAATCGCGTTA
CKO_03130 yihV -70 3.6 AAAATTGACAGCCGTCACTTTT
CKO_03830 yjcB -150 5.7 TATTGTGATATAGTTCACAAAA
CKO_03647 yjfP -136 3.9 AATTGTTATCTCTCACGCGATT
CKO_03647 yjfP -94 3.6 AAGCGTAATCCACTTCTCAACA
CKO_03443 cstA2 -228 5.2 ATTAGTGATCTCAATCACATAA
CKO_03411 yjjI -75 3.7 CACTTCGATATACATCACAGTT
CKO_03411 yjjI -22 4.4 TAACGAGATCCACTTCAAATAA
CKO_03386 yjtD -222 3.7 AGGTGTGATTCATTCTAAATTA
CKO_03386 yjtD -53 4.2 TATGTTGACATTGGTCACATTA
CKO_00659 yohC -81 4 TTATGCGCTGTACATAAAATAA
CKO_00648 yohJ -68 4.6 TGATGTGATCGGTAGCACGTTT
CKO_04222 yqeF -92 4.6 CTTTGTGATAAAACTCACCATT
CKO_04691 yrdA -221 3.9 TCTTGTGAAGCGTTTCACTTTG
CKO_04691 yrdA -81 3.8 ATTTTTGATACCTGAAACACTT
CKO_04821 igaA -290 3.9 TTGTGCGATATACAGCACGGTT
CKO_04821 igaA -238 3.7 TTATGTAACGTAGTAAAAATTA
CKO_03603 ytfQ -130 3.7 AGTTGTGATTAACCTTTTATTT
CKO_03260 pdhR -180 3.2 ATTTGTGCATAGTTACATCTTT
CKO_03260 pdhR -157 3.1 AAACGTTATTTCTGTAATCTTG
CKO_01593 mlc -107 3.6 AAaTGTGcagTAaATCACAcgg
CKO_03260 pdhR -120 3.2 TTTACTGATTTCAATCAAAACC
CKO_02831 prpR -179 3.4 AATTTTGTTTTTTCTTATAATT
CKO_03260 pdhR -148 3.3 TTCTGTAATCTTGTTAAAATGT
CKO_05043 aldB -94 3.6 TATCGTGACCGCAGTCGTAAAG
CKO_00005 uhpT -152 4.7 TTACGTGACGGACTTCACCTTT
CKO_03036 argC -110 4 ATTTGTGAATAAAAATACATTA
CKO_03349 caiF -144 3.8 AAGCACGATTTCGCTCACACTA
CKO_03906 aceB -166 3.3 TATTTTTATTGTTATCAATAAG
CKO_03376 proP -115 3.7 TTCTGTGACATAAATTACGCAG
CKO_04836 gntT -178 3.8 ATATGTTACCCGTATCATTCAT
CKO_04836 gntT -236 4.2 TAACATGACCTGCCTCTCATAA
CKO_05032 yiaJ -63 3.8 GATCGTGAACTGAAACACACTT
CKO_04874 ugpB -185 3.3 TATTTTTCTGTCATTCGCGCAT
CKO_04874 ugpB -162 3.2 TCATGTTACCTCGCGAGCATAA
CKO_03748 dcuB -52 3.9 GACTGTGATCTATTTATCAAAA
CKO_02986 hupA -179 3.4 AAACGTGATTTAACGCCTGATT
CKO_00148 cyaA -174 4 AGGTGTTAAATTGATCACGTTT
CKO_02849 tnaA -298 4.7 TTTTGTGATTTTTATCGCGGAT
CKO_03643 ulaA -124 3.9 ATTTGCGTGGTGCGTCACAATT
CKO_03643 ulaA -87 3.8 TGTTGTGATTACTTTTGAAAAT
CKO_04775 yhfA -187 3.3 GAATGTGATGTCCTCTGCATAC
CKO_00638 folE -98 3.8 TTATGTGCGCCGCCTCACGCAC
CKO_01626 malI -103 4 TAGTGCGGCGCAAATCACATTA
CKO_01626 malI -56 3.9 ATAAGTGATTGATAAAACGTTT
CKO_01626 malI -42 3.6 AAACGTTTTATCTGTCACGTTA
CKO_03268 ppdD -146 3.4 TTTTTCGAGCGGCCTCGCAAAC
CKO_01789 gdhA -107 3.4 TTTCTTGCTTACCGTCACACTG
CKO_03256 lpdA -95 3.3 AATTGTTAACAATTTTGTAAAA
CKO_02720 hupB -214 4 AATAGTGACCTCGCGCAAATAG
CKO_01318 adhE -242 4.9 AAATTTGATCTGGATCACGCAA
CKO_00640 galS -106 3.4 CCCTGTGACCTTACTCACGTAG
CKO_00640 galS -157 3.5 GATAACGATCTGGATCACATTC
CKO_02165 serC -171 4.6 TTGTGTGACGTAGCGCGCATTT
CKO_02029 csgD -207 4.1 TTTTGTTACAAGTTTAACACTT
CKO_00542 ubiG -249 3.8 AACAATGACCGACATCGCATAA
CKO_01456 trg -108 3.7 AAATGTGACAAACATTCCGATT
CKO_00775 sbmC -219 3.5 GAGTGCGAGTCTGCTCACATAC
CKO_00279 guaB -165 4.2 ACATGTGAGCGGGATCAAATTC
CKO_00245 csiE -42 3.6 TTTAGCTATCCTTATCAAACAA
CKO_00245 csiE -105 3.4 TTCTGTGATGCTCGCCAGCATT
CKO_04101 rpoS -270 3.3 TAATCTTATTATCATCAAACAC
CKO_04437 glgS -118 3.4 AAGTGTGATGTCAGGCAACTGA
CKO_04317 metK -199 3.5 CAACGAGAGTTGATTCAAAAAA
CKO_05054 mtlA -110 3.4 TTCAGTGCCAGATTTCGCACTA
CKO_05054 mtlA -203 5.2 TTTTGTGATCAATATCACATCA
CKO_05054 mtlA -159 5 TCATGTGATCCAAATCACACAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_03742 yhfA -188 3.5 TAATGTGAACTCCTCTGCATAC
KPN_03743 crp -158 3.3 TACATTGATGTACTGCATGTAT
KPN_02726 fadL -264 4.7 TTAAGTGACAGAAATCACACTT
KPN_02726 fadL -242 3.9 AAAAATGATCTAAAACAAAAAT
KPN_03942 mtlA -208 4.9 TTTTGTGATCATCATCACTAAA
KPN_00120 lpdA -105 3.3 AATTGTTAACAATTTTGTAAAA
KPN_00117 pdhR -155 3.2 AAATGTTATTTCTGTAAGGTTG
KPN_00117 pdhR -118 3.2 TTTACTGATTTCAATCAAAACC
KPN_00402 hupB -214 4 AATAGTGATTCTGCGCAAATTG
KPN_03652 aaeR -55 5.1 ATGTGTGATCTAAATCACTTTT
KPN_02687 ackA -95 3.8 AGGCATGATGTTAATCATAAAT
KPN_01501 aldA -137 4.4 TTTTATGAATCAGCTCACAGAA
KPN_00062 araB -130 3.9 ATATTTGCACGGCGTCACACTT
KPN_00063 araC -229 4.4 AAGTGTGACGCCGTGCAAATAT
KPN_03264 araE -191 4.4 AAGTTTAATGTCCATCACAAAA
KPN_02396 araF -161 4 CGATGTGATAATGCTCTCGTAT
KPN_02396 araF -72 3.6 TGTTTTGATGACGATTAAATTG
KPN_04246 argE -27 4 TATTGTATTTTTATTCAAAATA
KPN_03350 iciA -107 3.8 CCCTGCGATGCAGATCACACAA
KPN_02923 aroF -159 3.8 TATTGTTATACGCATCGCGCCA
KPN_02162 aroH -63 4 TATCGTGATGCGCATCACTTCC
KPN_03051 ascF -168 4.1 CTTAGCGATCAAAATCACAAAA
KPN_04529 aspA -204 3.9 AGCGGTGACCCATTTCACAGAT
KPN_04529 aspA -154 3.8 ATAAGTGATCAAGCTTACTGAT
KPN_01493 astC -274 4 TATCTTGATGATCTTCAAAAAG
KPN_04144 atpI -262 4.7 TTATGTGATCTGATGCACGCTT
KPN_02796 b2462 -102 4.3 CTGAGTGATCCACTTCACCTTT
KPN_02579 arbG -154 4.2 AGTCGCGATCTTAATCACGTTT
KPN_02584 cdd -78 4.4 GAATGAGATATTCATCACATAT
KPN_01999 cfa -230 4.1 ATCCGTGAGATTTCTCACAAAG
KPN_00054 citA -269 4.3 TAATGTGAAGCTTCCCAAATTA
KPN_03912 CKO_05006 -106 4.5 CTTCGTGATGCCGATCATAAAT
KPN_00914 clpS -167 4 AAATTTGAAGCAGTTAACGCTA
KPN_00914 clpS -77 4.3 ATTTGTGATGAGCATAACCTCT
KPN_04607 cpdB -156 3.8 TTGTTTTATTTATATCGCATCA
KPN_04607 cpdB -87 3.7 TTTTCTGGCAAGATTCACATTT
KPN_04607 cpdB -35 4.2 TTCTGTGCTATCGCTCATAAAA
KPN_04852 creA -42 3.8 TTTTTTAATAATGGTAACAATA
KPN_00913 cspD -270 4.2 AGAGGTTATGCTCATCACAAAT
KPN_00913 cspD -180 4 TAGCGTTAACTGCTTCAAATTT
KPN_00616 cstA2 -138 4.1 TTAAGTGATCTCGCTAGCAATG
KPN_04601 cycA2 -192 4.7 TTTTGTGAGCTATTTCGCGTTA
KPN_04601 cycA2 -169 3.8 ATGAGTGATATAACACTCACTT
KPN_00736 cydA -252 3.6 TATATTGATCACCGTCGAAAAA
KPN_04608 cysQ -178 4.1 TTTTATGAGCGATAGCACAGAA
KPN_04608 cysQ -126 3.7 AAATGTGAATCTTGCCAGAAAA
KPN_04608 cysQ -57 3.9 TGATGCGATATAAATAAAACAA
KPN_04229 cytR -162 3.6 TCTTGCGAGCCGGATCGAAAAA
KPN_04229 cytR -143 3.9 AAATTTAACAAGCATCACGTTT
KPN_02309 dadA -106 4.1 TGCTGTGAGTTAAGTCACCATA
KPN_03878 dctA -143 3.9 TTGTGCGAGTCAGCTCAAAGAT
KPN_03570 deaD -154 3.8 TTTTTTGCTTGCCATCACCTTC
KPN_03570 deaD -99 4.4 TACTTTGAGCCGGTTCACACAT
KPN_04837 deoC -158 5.2 ATTTGTGATTTTAATCACGTTA
KPN_04837 deoC -105 3.7 AACTGTGATGAATGTCGAAGTG
KPN_04098 dgoR -154 4.1 TTTTGTGATCCAAATTGTAGTA
KPN_03899 dppA -62 4 ATATGCAAACAACATCACAATT
KPN_04079 dsdC -125 3.9 AAAGGTGATTTAGCTCTAAAAG
KPN_04079 dsdC -95 4.2 AAATATGCTATGGGTCAAATTA
KPN_04080 dsdX -152 4.3 TAATTTGACCCATAGCATATTT
KPN_04080 dsdX -122 3.7 CTTTTAGAGCTAAATCACCTTT
KPN_03356 epd -213 4.8 AAATGTGATGTGAGTCATATAG
KPN_02226 CKO_01286 -125 3.7 TTTTTTGATCAAAATCAGCATC
KPN_02226 CKO_01286 -88 3.7 TGGTGTGATGCACAGAGCAAAG
KPN_02226 CKO_01286 -69 3.7 AAGTGTGAACAATATCACGCGA
KPN_03521 exuT -263 4.4 TTTTGTGACAGCTCTCAACTTT
KPN_02322 fadD -97 3.7 AATAGTGACGCGCTTCGCAACC
KPN_03510 fadH -111 3.9 TTCTTTGAATCCCATCACAATC
KPN_04626 fbp -164 3.9 TTTTCTTATCCGGGGCACATTT
KPN_00932 focA -121 3.8 AGATATGATCTATATCAATTTC
KPN_00460 fsr -197 3.8 AATTGCGACTTCCTTCAAACCT
KPN_03151 fucA -155 4.4 ATAATTGACGCGGCTCACAAAA
KPN_03152 fucP -260 4.7 TAAAGTGACAATAATCACATAA
KPN_03152 fucP -220 4.6 AAGTGTGACCATCATCATATTA
KPN_04530 fxsA -140 3.7 ATCTGTGAAATGGGTCACCGCT
KPN_00773 galE2 -78 3.7 TAACTTGTGCTATGTCACACTT
KPN_00773 galE2 -44 4.1 ATATGCTATCTTCCTCACAAAC
KPN_03376 galP -84 3.8 AGCCGTGATTATAGTCACGTTT
KPN_01197 gapA -225 5.2 AATTGTGACTTAAATCACGTTT
KPN_03540 garD -125 4.8 AGGAGTGATGCCGATCACATTT
KPN_03539 garP -289 4.5 AAATGTGATCGGCATCACTCCT
KPN_00854 CKO_02295 -103 3.9 TGAAATGAGCGAGATCGCATAT
KPN_02738 glk -117 4.4 AAATGTGACCTGTGTCGCTAAA
KPN_04178 glnA -299 3.9 CTTTGTGACCGCTTTCACGGAG
KPN_02647 glpA -165 4.3 TACTGTGAAACATCGCACAATT
KPN_02647 glpA -115 3.8 ATGTGAGCACGAAATCACATAA
KPN_03792 glpD -119 3.7 ATATGTTACACCCATCACTTCA
KPN_03792 glpD -58 3.7 TATAGTGAGCGATATCGAGCAT
KPN_03791 glpE -107 4.3 TGAAGTGATGGGTGTAACATAT
KPN_04010 glpF -145 3.7 TTTCTTGACGAGACACACACAT
KPN_02646 glpT -218 3.8 TTGTTTGATTTCGAGCATATTC
KPN_02646 glpT -178 4.6 TTATGTGATTTCGTGCTCACAT
KPN_02646 glpT -128 4.5 AATTGTGCGATGTTTCACAGTA
KPN_03801 gntK -129 4.7 AAGTTTGAAGTAGATCACACAT
KPN_04304 hemC -232 4.2 AAACGTGATCAATTTAACACCT
KPN_04789 hpaG -125 4.4 TTGTGTTAATCCGATCACAAAA
KPN_04790 hpaR -183 5 TTTTGTGATCGGATTAACACAA
KPN_00133 hpt -134 5.4 AAGTGTGATCGGAATCACAAAT
KPN_00795 hutU -124 4 AAACGTGATTGCTGACGCAATA
KPN_00854 CKO_02295 -103 3.9 TGAAATGAGCGAGATCGCATAT
KPN_pKPN3p05871 lacZ -109 4.6 TAATGTGAGTCAGCTCACTCAT
KPN_02134 lpp -56 3.6 TTGTGTAATACTTGTAACGCTA
KPN_03507 lsrA -162 3.8 AAGTGTGAGCCGACTGGCAAAA
KPN_00440 maa -100 4.7 CTTTGTGATAGACATCACATCA
KPN_04423 malE -167 3.8 TTCTGTGCTCCAGGACGCAATA
KPN_04423 malE -138 4.4 TTTTGCAATGGAGATCACACAA
KPN_04424 malK -254 4.5 TTGTGTGATCTCCATTGCAAAA
KPN_04424 malK -225 3.7 TATTGCGTCCTGGAGCACAGAA
KPN_03787 malP -133 4.4 TATAGTGTTCAGGATCACACTT
KPN_03935 malS -146 3.7 AAATGCTAGCTTCGTCTCATTT
KPN_03788 malT -142 4.4 ATTTGTGACATAGAGCAAATTC
KPN_02333 manX -163 3.8 TTAACGGATCTTCATCACATTA
KPN_02588 mglB -239 4.8 ATTTGTGAGTAAATTCACAGTA
KPN_03036 mltB -296 4.3 AAGTGTTAAATGGATCGCAAAA
KPN_00699 nagB -217 3.8 AAAATTAATTCGTATCGCAAAT
KPN_00699 nagB -183 5 TTTTGTGATAATTATCACCAAA
KPN_00700 nagE -153 4.7 TTTGGTGATAATTATCACAAAA
KPN_00700 nagE -119 3.6 ATTTGCGATACGAATTAATTTT
KPN_01106 ndh -152 4.1 AAACTTGATGCACATCAATTTT
KPN_03768 nudE -54 4 AAGCGTGTTGCGTATCGCACAA
KPN_03396 nupG -49 4.2 TAATGTTATTTTAAAAACATAA
KPN_00986 ompA -185 3.9 ATGCCTGACAGAGTTCACACTT
KPN_01248 ompW -101 3.9 CATTGCGATCGGTAGCAAAAAT
KPN_01248 ompW -45 4 TAGTGTGATCTAAAACAGATCA
KPN_03773 pck -242 3.7 GAAAGCGATTACATTCACATTT
KPN_03773 pck -138 3.7 CTTCGTGACAGGAGTCACCGTT
KPN_04321 pldB -56 3.8 TTGTGTGATACACGGTAAAAAA
KPN_03749 ppiA -189 3.9 TATTGTGAAATGGGTTATCTTT
KPN_03749 ppiA -158 5.3 TAATGTGATCTGCATCACGCTT
KPN_04242 fsaB -139 4.9 AAATGTGATCTAAATCATCCTT
KPN_01099 ptsG -155 4.4 AAACGTGATAGCCGTCAAACAA
KPN_02762 ptsH -206 4 TTTTATGATTTGGTTCAAGTCT
KPN_02421 rcsA -195 3.7 TGTTTTTAATTCGGTCACACTA
KPN_04213 rhaB -128 4.2 AACTGTGATGTCCCTCACGGTC
KPN_04214 rhaS -204 3.8 GACCGTGAGGGACATCACAGTT
KPN_04216 rhaT -149 4.7 TTTTGTGATGTAGAACAACTAA
KPN_03139 sdaC -158 4.2 ATTTGAGATCGCGATCACTGAT
KPN_03348 serA -214 4.6 TTTGGTGACTTCTGTCACATTT
KPN_04217 sodA -150 4 TTAGTTGTTCTACATCACAAAA
KPN_02608 spr -292 3.6 TAGGGTAATCTCGTTCTCGTTT
KPN_02608 spr -234 4.2 AATTGTGCGTGACTGCACAAAT
KPN_03262 scrT -135 4.4 ATTTTTGATCGCGATCGCATCT
KPN_03262 scrT -94 5.1 TTTTGTGATTAACATCATATAT
KPN_03262 scrT -46 3.6 TTTTGTTAACGTTACCATAATT
KPN_03037 srlA -92 4.6 TTTTGCGATCCATTTAACACTT
KPN_00115 araT -171 4.7 CATTGTTATCTGCTTCACACTT
KPN_01748 CKO_00488 -155 4.2 AACTGTGATACACCTCCCAAAG
KPN_01748 CKO_00488 -53 3.6 AGTTATAATGCGATTCGCAGAT
KPN_04633 CKO_03591 -172 4.3 TGTTGTGATACATCTCACGCCA
KPN_04633 CKO_03591 -121 4.2 ATATGTGGAGTCGATCACCTAA
KPN_02798 talA -80 3.7 TTTGGTTATGTACCTCATCAAT
KPN_02296 tdcA -82 4.6 CTTTGTGAGAGCTCTCACATAA
KPN_02296 tdcA -54 3.7 AATTGCGATTTGTTACACTTTC
KPN_00415 tesB -139 3.8 AAGTGTGGCACAGATCTCAGAT
KPN_00363 tsx -131 3.8 TTATGTGAAACAACACGTATTT
KPN_04327 udp -143 5.2 TAATGTGATGTGTATCACTATT
KPN_04327 udp -91 4.1 CTTGGTGACTATCATCACAAAA
KPN_00461 ushA -125 3.9 AATTATTATCCAACTAACATAC
KPN_00461 ushA -94 3.7 AGGTTTGAAGGAAGTCGCAATT
KPN_03520 uxaC -251 3.8 AAAGTTGAGAGCTGTCACAAAA
KPN_03520 uxaC -129 4.4 TTTATTGATCTAACTCACGAAA
KPN_03929 xylA -234 4.1 TTTTGCGAGCTGGCGCACGTTT
KPN_03930 xylF -234 3.8 AAATACGATCGCCGTCATAATT
KPN_00137 yadI -69 3.8 ATCTTTGACTCCCATCACCGAT
KPN_00177 cdaR -57 3.8 TTCTGTGACCGCCCCCACAACT
KPN_00238 yafK -208 3.7 AAATGCGAGCTATTGCGCAAAG
KPN_00416 ybaY -99 3.8 ATCTGAGATCTGTGCCACACTT
KPN_00663 ybeD -97 4.4 AAGTGTGATTTCCATCCCCATA
KPN_00818 ybhP -56 4.2 TTTTGTGACGTCTACTACACTA
KPN_00819 ybhQ -97 3.8 TAGTGTAGTAGACGTCACAAAA
KPN_00825 KPN_00825 -224 3.6 AAATGAAACGGTATTCAAAAAA
KPN_00825 KPN_00825 -118 4.7 AATTGTTAAGCCCATCACAAAT
KPN_01059 ycdZ -52 4.1 TACTGTGTTTTAGATCGCATTC
KPN_01109 ycfQ -227 4.8 TAATGTGATCTATGTCACACGT
KPN_01110 ycfR -95 4.9 ACGTGTGACATAGATCACATTA
KPN_02310 ycgB -174 4 TATGGTGACTTAACTCACAGCA
KPN_02198 ychE -261 4.8 TTACGTGATTTAGATCAAGTAT
KPN_02241 ychH -100 4.1 TAATGTGATCGTGGACGCACTC
KPN_01950 ydcI -75 3.8 TTTTGCTATCTGGTTATCAAAT
KPN_01628 sotB -94 4.8 AAATGAGACGCAGATCACAAAA
KPN_01995 ydhP -99 4.3 TTTTGTCATTTCGTTCACTTTT
KPN_01995 ydhP -73 4.4 TTTTGTGATTGATGTCATGCTT
KPN_01198 msrB -135 5.1 AAACGTGATTTAAGTCACAATT
KPN_02368 hexR -134 3.6 AAATACGACCCTGATCATGTAA
KPN_02614 yejG -204 3.8 AAAGTTGTTTTGGATCACAGAA
KPN_02739 yfeO -192 4.3 TTTAGCGACACAGGTCACATTT
KPN_02755 yfeR -112 3.6 AAAATTGATTTATTGCATCTAT
KPN_02804 yffB -218 4 TAATGTGACGTAGAGCAACCTC
KPN_02804 yffB -179 4 TAATGTTAAAGCCCTCACATCA
KPN_02919 raiA -88 5.6 AAATGTGATTTATATCACACAT
KPN_02902 grcA -124 3.9 TTTATTGATTTATATCAAGGAA
KPN_01606 ygbI -271 3.6 TAATGTGATTTAATGATAGAAT
KPN_01606 ygbI -230 4.7 ATATGTGAGAGTTATCACGAAT
KPN_pKPN4p07051 ygbI -233 3.6 TAATGTGATTTAATGATAGAAT
KPN_pKPN4p07051 ygbI -192 4.7 TTATGTGAGAGTTATCACGAAT
KPN_01605 ygbJ -91 5 ATTCGTGATAACTCTCACATAT
KPN_04419 yhaM -230 3.6 CGCTGTGAGCAGATTAACAAAA
KPN_03618 elbB -93 3.6 ATTTGTTACATGAATCAGTAAA
KPN_03618 elbB -71 3.8 ATATGTGAAGCATAGCGAGTTA
KPN_03646 yhcN -106 3.6 TATTGTAACTATTAACGCACAA
KPN_03646 yhcN -37 5 TTTTGTGATGAGGGTCACGAAA
KPN_03651 yhcR -116 5.2 AAAAGTGATTTAGATCACACAT
KPN_03651 yhcR -63 3.7 TATTGTTAGCTACATAATAAAC
KPN_03750 yhfC -140 5.3 AAGCGTGATGCAGATCACATTA
KPN_03750 yhfC -109 3.7 AAAGATAACCCATTTCACAATA
KPN_03874 yhjE -154 4.3 TTGTGTGAAGCATTTCATAGAA
KPN_04013 uraA1 -143 3.7 TGATGCGATTTAGCATACAAAA
KPN_03994 yicG -55 4.9 AATCGTGATCCTGCGCACAAAT
KPN_04101 yidA -56 4.1 TTTTTTGAGCGGAATCGCGTTA
KPN_04266 yifB -226 4.1 TTATATGAAAAAAATCAAAAAT
KPN_04460 yjcB -143 5.4 AAGTGTGATATAGTTCACACAA
KPN_04776 cstA2 -231 5.2 TATTGTGAGCTTAATCACACAT
KPN_04857 yjtD -94 4 TTTAGTGATTTTTGTTGCAAAT
KPN_01574 mlc -104 3.8 AAATGTGCGGTAAATCACAAGG
KPN_02574 yohC -123 4.1 TTCTGTGCTGTACATAAAATAA
KPN_02582 yohJ -68 5 TGATGTGATCGGTAGCACATTT
KPN_03268 yqeF -105 4.6 CTTTGTGATTGGCTTCACTTTT
KPN_03349 rpiA -82 3.9 TTGTGTGATCTGCATCGCAGGG
KPN_03680 yrdA -221 4.6 TTGTGTGAAGTGATTCACATCT
KPN_03769 igaA -282 3.8 TTGTGCGATACGCAACACGCTT
KPN_02367 zwf -225 3.8 TTACATGATCAGGGTCGTATTT
KPN_00602 fepA -239 3.4 TAGCGTGACTTTTTTAATTAAT
KPN_00124 acnB -260 3.5 TTTTGTAAACAGATTAACACCT
KPN_02991 aldB -205 4.4 TGTTGCGATTTGCAACACATAA
KPN_02600 fruB -177 3.5 AAGTGTGCAGTACCTCTAAGTT
KPN_04478 acs -101 3.9 TTGCGTGATCTGCCCCCCAATT
KPN_00010 proP -105 3.2 TGATATAACCTGCATCGCTAAT
KPN_03813 ugpB -88 3.4 TATTTTTCTGTAATTCGAACAT
KPN_04382 hupA -179 3.4 AAACGTGATTTACCGCCTGAAT
KPN_04069 uhpT -153 4.8 AAGCGTGATGTAGCTCACCCTT
KPN_04305 cyaA -147 4 AGGTGTTAAATTGATCACGTTT
KPN_04586 ulaA -125 4 TATTGCGGCGCGCGTCACATTT
KPN_04586 ulaA -88 3.3 TGTTGTGATTATTTTTGATTAT
KPN_02591 folE -84 3.5 TTCTGTGCGCCACCTCACGCAC
KPN_02199 adhE -237 4.7 ATACTTGATCTAAATCACGTAA
KPN_03508 lsrR -75 3.7 TTTTGCCAGTCGGCTCACACTT
KPN_02992 prpR -81 4.1 TTATGTGTTGCAAATCGCAACA
KPN_01469 paaA -131 3.7 TTTTGCGGAGATTATCACAAAA
KPN_01469 paaA -197 3.8 CATTGTGATCGCGATGGCGTTA
KPN_02641 ubiG -236 3.8 AACAATGACCGACATCGCATAA
KPN_01468 paaN -177 4.4 TTTTGTGATAATCTCCGCAAAA
KPN_01468 paaN -246 3.3 TTATGTGAATCACTTTGTTTAT
KPN_03383 csgD -275 3.5 TTTGGTAATACAAATAACTTTT
KPN_00935 serC -145 3.7 TTGTGTGACGGCGGCCGCGTTT
KPN_02589 galS -33 3.6 TGACGTGCTGTAATTCTCTTAA
KPN_02589 galS -109 3.4 CCGTGTGACCTCACTCACGCAG
KPN_02589 galS -160 3.3 GATAACGATCTCGATCACAATC
KPN_02467 sbmC -88 3.6 CTCTGTGAATTCGCGCACATAC
KPN_02834 guaB -162 4.3 ACATGTGAGCAAGATCAAACTT
KPN_03375 metK -199 4.3 AAATGCGACCGCCATCAAAAAA
KPN_03942 mtlA -164 5.2 TCATGTGATCCAAATCACATAA
KPN_03942 mtlA -115 3.4 TTCAGTGCCAGATTTCGCACTA
Enterobacter sp. 638
Ent638_2753 folE -84 3.9 TTATGTGCGCCACCTCACGCAC
Ent638_3784 crp -128 2.9 AAACATTACAGGCTGCAAACAT
Ent638_0136 mtlA -224 3.4 TATTTTTTTCATACTCTCATTT
Ent638_2884 fadL -269 4.2 GTAAGTGACCGATATCACACTA
Ent638_2884 fadL -247 4 AAAAATGATCTAGCGCAAAAAT
Ent638_2884 fadL -214 3.7 ATGAGTGCGACGGCTCGCATTT
Ent638_3680 aaeR -37 5.3 ATATGTGATCTAAATCACTTTT
Ent638_2840 ackA -96 3.8 TGGCATGATGTTAATCATAAAT
Ent638_0276 acs -101 4.1 TTGCGTGATCTGTCGCCCAAAT
Ent638_3527 aer -106 4.5 AATTGCGATCTGGATCAATTTT
Ent638_1953 aldA -113 4.7 TTTTATGAGATATCTCACAAAA
Ent638_0259 aphA -57 3.8 TTTTTTGACCATTCGCTCAATT
Ent638_0610 araB -130 3.8 TTATTTGCACAGCGTCACACTT
Ent638_0611 araC -228 4.4 AAGTGTGACGCTGTGCAAATAA
Ent638_3294 araE -209 3.7 CGAGATGACATCGATCACATTT
Ent638_3294 araE -130 4.1 AATTGGAATATCCATCACAGAA
Ent638_2476 araF -162 3.7 CGGTGTGATGGCGCTCTCTTAT
Ent638_4029 argE -66 4.2 TAGTGTATTTTTATTCACATTT
Ent638_3334 iciA -126 3.9 CCCTGTGACCGGTGTCACATTA
Ent638_3334 iciA -48 3.7 ATTTGTGTCATAGTGCAGAATA
Ent638_1743 aroH -126 3.6 AGTTATGATCGCTTTCACTCTC
Ent638_1743 aroH -62 3.6 TAAGGTGATGCCCATCACTTCC
Ent638_3188 ascF -128 4.4 CAAAGTGATCGTTATCACGAAT
Ent638_3188 ascF -54 3.7 TTTTGTGAAACCGGTTTCCTAT
Ent638_0326 aspA -205 4.1 AGCGGTGATTCATTTCACAGAT
Ent638_1696 astC -274 3.7 AATTTCGCGAGCGATCACAAAT
Ent638_4125 atpI -261 4.8 TTTTGTGATCTCGTGCACGCTT
Ent638_0151 bax -219 4.2 ATGAGTGATCTCGCGCAAAATT
Ent638_0151 bax -189 4.1 ATCTGCGATATCGCACACAATT
Ent638_0151 bax -72 4.3 ATTTGAGATTCCGCTCTCAATT
Ent638_2741 arbG -153 3.9 GATCACGATCTAAATCACATTT
Ent638_2746 cdd -127 4.2 ATTTGCGATGCGTCGCGCAATT
Ent638_2746 cdd -77 4.9 TAATGAGAACTGGATCACATAT
Ent638_1786 cfa -79 4 TTCCGTGAGACTTCTCACAAAC
Ent638_1706 chbB -129 3.9 AATTTTGATTAACCGCGAATTA
Ent638_3378 citA -292 4.1 TTATGTGAGGAACGGCATATTA
Ent638_0170 CKO_05006 -97 4.4 CTTCGTGATGGCGATCATAAAT
Ent638_1398 clpS -161 3.9 ATTTTTGAAGCAGTTAACGCTA
Ent638_1398 clpS -132 3.8 GAATGTGACAGATATCGCGGAT
Ent638_0392 cpdB -34 4 TTTTGTGGCTTGGATCGAAAAA
Ent638_1397 cspD -209 3.8 ATCCGCGATATCTGTCACATTC
Ent638_1397 cspD -180 3.9 TAGCGTTAACTGCTTCAAAAAT
Ent638_1159 cspE -114 3.8 TAACGCGACTTTTGTCACTTTT
Ent638_1130 cstA2 -138 4.3 TAAAGTGATCCGCTTAACACAG
Ent638_0378 cycA2 -201 4.2 TTTTGTGAGCTGTTTTGCATTG
Ent638_0393 cysQ -167 3.9 TTTTTCGATCCAAGCCACAAAA
Ent638_2363 dadA -107 4.3 AGGTGTGAGGTAAGTCACCATA
Ent638_3599 deaD -154 4.1 TCTTATGATTGCCATCACCTTA
Ent638_3599 deaD -99 4.4 TACTTTGAGCCGGTTCACACTT
Ent638_0541 deoC -151 4.6 AAATTTGAAGTGGATCTCATTA
Ent638_0541 deoC -98 3.7 AACTGTGATGAATGTCGAAGTG
Ent638_0006 dgoR -154 4.2 TTTTGTGATCCAGATTGTAGTA
Ent638_3699 dusB -299 4.1 AAATGGGACCCAGATCGCAAAG
Ent638_3340 epd -215 4.5 AAATGTGACGCAAGTCATATAG
Ent638_2329 CKO_01286 -125 3.7 TTTTTTGATCAAAATCAGCATC
Ent638_2329 CKO_01286 -69 4.3 AATTGTGAACAACATCACGCTC
Ent638_3547 exuT -261 4.2 TTTCGTGAGTTAGATCAATAAA
Ent638_3547 exuT -139 5.2 TTTTGTGATGTCACTCACCTTT
Ent638_3539 fadH -111 3.9 ATCTTTGAATCCCATCACATTC
Ent638_2365 fadR -21 3.8 CTGTGTAATGGAAATCTCACTA
Ent638_2470 flhD -285 5.5 TTTTGTGATCTAGGTCACACTT
Ent638_1424 focA -78 3.8 AGATATGATCTATATCAATTTC
Ent638_2763 fruB -178 4.3 AAATGTGCTGCACTTCTAAATT
Ent638_0958 fsr -92 4 AATTGCGACTTTCCTCAAATCT
Ent638_0327 fxsA -151 3.8 ATCTGTGAAATGAATCACCGCT
Ent638_3347 galP -171 3.9 TATTGGGATGCACATCAACTCT
Ent638_3347 galP -102 3.7 TAGTGTAACCGATTACACCAAT
Ent638_3347 galP -84 5.3 CAATGTGATTTATCTCACATAT
Ent638_1675 gapA -225 5.7 AATTGTGATCTTTCTCACATAT
Ent638_3570 garD -143 4.7 AGGGGTGATCTTGATCACATTT
Ent638_3569 garP -291 4.7 AAATGTGATCAAGATCACCCCT
Ent638_1314 CKO_02295 -122 4.1 TTTTGTGCAAGCTTTCTCATAA
Ent638_2921 glk -116 3.8 TTCTGTGACGAAGATCGATTAT
Ent638_2805 glpA -163 4.1 TACTGTGAATCAACGCACAGAT
Ent638_3835 glpD -116 4.4 TTATGTTATCTCTATCACTCAA
Ent638_3835 glpD -55 4 TATTATGAGCGATATCGAACAT
Ent638_3834 glpE -257 3.8 ATGTTCGATATCGCTCATAATA
Ent638_3834 glpE -196 4.6 TTGAGTGATAGAGATAACATAA
Ent638_4046 glpF -213 4.4 TGAAATGATTCAGCTCACATTT
Ent638_4046 glpF -147 3.8 TTTATTGACACAGCACACACAT
Ent638_2804 glpT -201 3.6 TTGTTTGATTTCGAACATAATC
Ent638_2804 glpT -161 3.8 AAGCGTGATCTCATGCGCTTAT
Ent638_2804 glpT -111 4 ATCTGTGCGTTGATTCACAGTA
Ent638_1182 glnH2 -106 3.8 AAATGTTAACAAGCTTGCATAA
Ent638_2642 gnd -116 4 CAGTGTGACATAGATCAGCAAA
Ent638_3845 gntK -120 4.6 AAGTTTGAACTAGCTCACACTT
Ent638_3656 gltB -298 3.9 GATAGTGAGTCAGATCACACTC
Ent638_3987 hemC -211 4.2 AAACGTGATCAATCTAACACCT
Ent638_0673 hpt -180 3.6 AATTTTGATAGCAATTAATTAT
Ent638_0673 hpt -148 5.4 AAGTGTGATCGGAATCACAAAT
Ent638_1263 hutU -120 4 AAGCGTGATAGCTAACGCAATA
Ent638_1314 CKO_02295 -122 4.1 TTTTGTGCAAGCTTTCTCATAA
Ent638_0928 lacZ -100 4.4 TTTTGTGATCGACTTCGCTTTG
Ent638_1767 lpp -56 3.6 TTGTGTAATACTTGTAACGCTA
Ent638_0939 maa -98 4.3 TGCTGTGACTCTGATCACATCA
Ent638_2958 maeB -231 4.1 ATACATGACGTACTTAACAAAA
Ent638_3830 malP -140 4 AAGAGTGGCCTTGATCACACTT
Ent638_0150 malS -264 4.2 AATTGAGAGCGGAATCTCAAAT
Ent638_0150 malS -147 4.1 AATTGTGTGCGATATCGCAGAT
Ent638_0150 malS -117 3.8 AATTTTGCGCGAGATCACTCAT
Ent638_3831 malT -142 4.6 AATTGTGACAGAGTGCAAATTA
Ent638_1827 malX -96 4.2 GAATGTGATTCAGAGCGCACTA
Ent638_2386 manX -166 3.8 ATTACGGATCTTCATCACATAA
Ent638_2750 mglB -271 4.4 ATCTGTGAGTAAATTCACAGTA
Ent638_1193 nagB -218 3.8 AAAATTAATTCGTATCGCAAAT
Ent638_1193 nagB -184 4.6 TTTTGTGAGTTTTGTCACCAAA
Ent638_1194 nagE -162 4.4 TTTGGTGACAAAACTCACAAAA
Ent638_1194 nagE -128 3.6 ATTTGCGATACGAATTAATTTT
Ent638_3661 nanA -112 4.6 TTTAGTGAAGCAGATCGCATTA
Ent638_1624 ndh -153 4 AAACTTGATTCATATCAATTTT
Ent638_3810 nudE -55 3.6 AACCGTGCGTCATATCGCACAA
Ent638_2927 nupC -189 4.7 TTTTGTGAAGCGTAGCACACAA
Ent638_2927 nupC -133 3.6 AAATGTATGGTTGATCACTATT
Ent638_2927 nupC -84 4.1 TAGTGTGGTCTTGATCTCGTTT
Ent638_3369 nupG -163 4.5 AAACGTTATTTGCATCACAATC
Ent638_3369 nupG -114 3.7 TTTTTTGCGGGAGGTAACAAAA
Ent638_1469 ompA -189 4 ATGCCTGACGGAGTTCACACTT
Ent638_1448 ompF -245 4.6 AAATTTGAGGTGGTTCACAAAG
Ent638_3818 ompR -147 3.9 TTATGTGATGAAATGTGCAGAT
Ent638_2283 ompW -121 3.7 AAAATTAATCTGGATCAACAAA
Ent638_0535 osmY -169 4 AATTGTGATCTATATTTAACTC
Ent638_3816 pck -241 4.1 GTATGCGATTACATTCACATTA
Ent638_1640 pepT -31 3.6 AAAAGTGACCTGACGCAATATT
Ent638_3971 pldB -56 4.3 TTTTGTGATGCGTCACGAAAAA
Ent638_3790 ppiA -161 4.7 CAATGTGATCTAAGTCACTTTT
Ent638_4030 fsaB -214 3.7 ACGCATGATCCCCATCACATTC
Ent638_1616 ptsG -155 4.4 AAACGTGATAGCCGTCAAACAA
Ent638_2943 ptsH -271 4.4 TTTTGTGGTCCACTTCAAACTT
Ent638_2943 ptsH -144 4 TTTTATGATTTGGTTCAAGTCT
Ent638_1542 putP -249 3.7 TTTTATGCGGCACTTAACACTT
Ent638_2542 rcsA -206 4.3 TGTTTTTATGCCCTTCACAATA
Ent638_4067 rhaB -129 4.2 AACTGTGAACTCCCTCACGTTC
Ent638_4066 rhaS -194 4.2 GAACGTGAGGGAGTTCACAGTT
Ent638_1148 rnk -187 4.1 AAATCTGAGAACGATCACGTTT
Ent638_1148 rnk -140 3.8 GAATGTGACATTCATCACTTCA
Ent638_3249 sdaC -176 4.1 ATTTGGGATCAGGATCACTGAT
Ent638_1222 sdhC -295 4.2 TATCGTGACTGTGATCACTGTT
Ent638_3332 serA -215 4.1 TTCGGTGACTTGTATCACGTTT
Ent638_2764 setB -208 3.9 AATTTAGAAGTGCAGCACATTT
Ent638_4063 sodA -160 3.6 CCGCGTGAGCAGACTCACAATT
Ent638_2771 spr -250 3.6 AATCGCTTTGTCTATCACAATT
Ent638_2847 CKO_00488 -178 4.1 AGCTGCGATCAAGATCACAAAG
Ent638_2847 CKO_00488 -129 4.6 AATTGTGATAGCGCTATCAAAT
Ent638_0424 CKO_03591 -265 3.8 AAACCTTATCCGCGTCACACTT
Ent638_0424 CKO_03591 -189 4.6 TAGCGTGATATTCATCACGCAA
Ent638_2959 talA -152 3.6 ATTTGTTATCAATTTATAACAA
Ent638_2959 talA -83 3.9 TTTTGTTAAGTACGTCATGTAT
Ent638_3565 tdcA -82 3.9 ATTTGTGAGTAACAGCACATCC
Ent638_0920 tesB -131 4 AAGTGTGGCACATATCACTTAT
Ent638_0564 thrA -252 4.4 AATTGTGATCAAATTAGAAATT
Ent638_0439 treB -106 4 TATTGTGATCTTCACCCGATTT
Ent638_0879 tsx -124 4.1 ATATGTGAAACAACACATATTT
Ent638_3962 udp -143 4.7 TAGTGTGATGCATGTCACTATT
Ent638_0959 ushA -95 3.9 AGATTTGAGGAAAGTCGCAATT
Ent638_3909 uspA3 -195 3.8 AAAGTCGATCGGGTTCACGTTT
Ent638_3546 uxaC -231 4.6 AAAGGTGAGTGACATCACAAAA
Ent638_3546 uxaC -109 4.4 TTTATTGATCTAACTCACGAAA
Ent638_2767 uxuA -116 3.9 TTCTGTGAGTTGGATCAATCAA
Ent638_0156 xylA -231 3.8 ATTTATGACCGTGATCTGATTT
Ent638_0156 xylA -135 3.9 TTTTGGGAGCCAGCGCACGTTT
Ent638_0155 xylF -264 3.9 AAACGTGCGCTGGCTCCCAAAA
Ent638_0677 yadI -68 3.8 TTTCTTGACTGCTATCACCGTA
Ent638_0921 ybaY -96 4.3 ATAAGTGATATGTGCCACACTT
Ent638_1166 ybeD -90 4.4 AAGTGTGATTTCCATCCCCATA
Ent638_1281 ybhP -57 4.2 TTTTGTGACGCCGACTACACTT
Ent638_1282 ybhQ -98 3.9 AAGTGTAGTCGGCGTCACAAAA
Ent638_1287 ybiH -126 4.4 TTTTGTGACACGGCGCATAAAA
Ent638_1310 ybiS -119 4.7 AAATGTGATTTCGTACACATCT
Ent638_1311 ybiT -125 4.4 AGATGTGTACGAAATCACATTT
Ent638_1626 ycfQ -174 4.6 AGATGTGATCTGCATCACACGT
Ent638_1627 ycfR -91 4.7 ACGTGTGATGCAGATCACATCT
Ent638_2364 ycgB -236 4.2 TATGGTGACTTACCTCACACCT
Ent638_2303 ychE -256 4 AAACATGATCTGAATCAATTTA
Ent638_2343 ychH -119 3.7 TGTTGTGACGAGAGTCATTAAT
Ent638_2343 ychH -101 4 TAATGTGATCATTCACGCAACT
Ent638_1964 ydcI -71 3.6 TTTTGCTATCAGGTTATCAAAA
Ent638_2000 sotB -95 4.9 TTTTGAGATCTGCGTCACATAA
Ent638_1914 ydgD -53 4.1 TATTTTAATAGGGTTCACTTTT
Ent638_1793 ydhD -186 3.6 TGAAGCGCTTTTGCTCACACTA
Ent638_1790 ydhP -73 4.3 TTTTGTGATTGCTGTCATGCTT
Ent638_1676 msrB -137 5.2 ATATGTGAGAAAGATCACAATT
Ent638_1658 yeaQ -245 3.7 CAATGTGAGCAATGTCGTACTA
Ent638_1658 yeaQ -101 4.8 CACTGTGATACCTATCACAAAT
Ent638_2677 yegH -42 4.4 AAGTGTGACAAATGTCATATAA
Ent638_2922 yfeO -111 3.7 ATAATCGATCTTCGTCACAGAA
Ent638_2966 yffB -254 4 TTATGTGACCAATAGCAATATT
Ent638_2966 yffB -77 3.6 ATATGTTATGTTTTGCCAAATA
Ent638_3076 raiA -81 5.4 ATGTGTGATTTAGATCACACAT
Ent638_3673 yhcN -58 5 TTTTGTGATGAGGGTCACGAAA
Ent638_3679 yhcR -165 5.4 AAAAGTGATTTAGATCACATAT
Ent638_3791 yhfC -206 4.8 AAAAGTGACTTAGATCACATTG
Ent638_3920 yhjE -155 4.2 AACTGTGAAGCATTTCATAGAA
Ent638_0073 uraA1 -169 3.7 CAAAATGATTCTTCGCACATAT
Ent638_0094 yicG -55 3.9 AATCGTGATATGTTCTGCAAAA
Ent638_0263 yjcB -82 5.3 AAACGTGATATAGTTCACACAT
Ent638_0540 yjjI -133 4.7 TAATGAGATCCACTTCAAATTT
Ent638_0563 yjtD -54 4.3 TATGTTGAGGTGGATCACACTT
Ent638_1919 mlc -107 3.8 AAATGTGCGGTAAATCACAAGG
Ent638_2744 yohJ -68 4.7 TGATGTGATCCGTAGCACGTTT
Ent638_3299 yqeF -94 4.5 CTTTGTGATTAAACTCACTTAT
Ent638_3333 rpiA -47 3.8 TAATGTGACACCGGTCACAGGG
Ent638_3711 yrdA -222 4.6 TTGTGTGAAGTGATTCACATCT
Ent638_3711 yrdA -47 3.6 TAATGCGATCAAAGTCTTCTAT
Ent638_3811 igaA -287 3.7 TTGTGCGATATGACGCACGGTT
Ent638_1685 gdhA -110 3.3 AATTTTCACTTGCCTCGCAAAG
Ent638_1116 fepA -228 3.6 TATTTTGTTTCAGGACAAATTT
Ent638_0660 aceE -77 3.1 TATTGTATTTTCTGGCGAAAAT
Ent638_0659 pdhR -68 3 TTTAGCGATACGAATATGAAAT
Ent638_0659 pdhR -120 3.2 TTTACTGATTTCAATCAAAACC
Ent638_0143 aldB -93 3.4 ATCCGTGATTCCTGTCGTAAAG
Ent638_3793 nirB -76 3.3 GTATTTGATTTGCATCAATAAG
Ent638_3828 gntT -236 4.1 TAACATGACCTGTGTCTCATAA
Ent638_3856 ugpB -162 3.5 AGTTATTATTCCCGCCACATTA
Ent638_3856 ugpB -58 3.2 TCATGTTACCTCGCGAGCATAA
Ent638_2479 dcuB -81 3.3 AAATCTGATCTGGCTCCCAGCC
Ent638_0213 hupA -179 3.5 AAACGTGATTTAACGCCTGTTT
Ent638_3986 cyaA -158 4 AGGTGTTAGATTGATCACGTTT
Ent638_0030 uhpT -150 5.1 AATCGTGATGTGCCTCACCTTT
Ent638_2304 adhE -253 4.1 TAAATTGATTCAGATCATGTTT
Ent638_3537 lsrR -122 3.4 TTTATTGATTAGGATCCAATTC
Ent638_2481 azuC -53 5.4 AACTGTGATGTGCATCACATAA
Ent638_0907 hupB -215 3.7 AATAGTGACCTCGCGCAAAGAG
Ent638_4028 argC -44 3.8 AAATGTGAATAAAAATACACTA
Ent638_2751 galS -109 4.1 CTGTGTGAGCTTCTTCACGTAG
Ent638_2751 galS -160 3.4 GATAACGATCTGGATCACAATC
Ent638_1427 serC -119 4.4 TTGTGTGACGGTGGACACATTT
Ent638_2481 azuC -23 4.7 TTTTGTGACTCTGGTCATATTA
Ent638_2481 azuC -48 3.2 TGATGTGCATCACATAATCATT
Ent638_1961 trg -110 3.5 AAGTGTGACCCACCTGGCGCTT
Ent638_2577 sbmC -65 3.6 ATATTTGCTGCACATAAAGAAT
Ent638_2577 sbmC -97 3.6 TCGTGCGAGTCTGCTCGCATAA
Ent638_2999 guaB -162 4.5 ACATGTGAGCAGGATCAAATTT
Ent638_3212 rpoS -273 3.3 TACGGTAATCTTATTATCATAA
Ent638_3346 metK -199 4.4 TAATGCGAGCGATATCAAAAAA
Ent638_0136 mtlA -205 4.8 TTTTGTGATGGCGATCACCTCA
Ent638_0136 mtlA -161 5.1 TTGCGTGATGCAGATCACACAA
Erwinia amylovora ATCC 49946
EAM_3417 mtlD -34 3.5 ACATGAGATTTGCATCATTAAT
EAM_3416 mtlA -166 4.8 TTAAGTGACCCGCATCACACTT
EAM_2348 fadL -194 3.9 TTTTGTTAAGCAGATCTCTTTT
EAM_0746 pdhR -198 3.3 TAAAGCGATCGGATTTAACAAT
EAM_3128 aaeR -37 5.3 AAATGTGATCTAAATCACTTTT
EAM_0327 acs -98 3.9 CTGCGTGATCTGCCGCGCAAAA
EAM_1697 araB -131 4.1 ACATATGAAGGCCATCACATAA
EAM_1698 araF -251 4.3 TTATGTGATGGCCTTCATATGT
EAM_0137 argE -66 3.8 TATTGTATTTTTATTCACTATT
EAM_3122 argR -91 3.8 ATTTGCAATTTGCATAAAAATT
EAM_0416 aspA -228 4.2 CAATGTGACCTGGAACAGATAT
EAM_1606 astC -69 4.3 ATTTTTAACCTTCATCACACTT
EAM_3481 atpI -264 4.4 ATTTGTGATCGTGGACACGCTT
EAM_2082 yedJ -129 3.8 TGATGTAATGAGCAACAAATAA
EAM_2082 yedJ -101 4.4 AAGTTTGATGTGGCTAAAATTA
EAM_2202 cdd -124 3.9 ACTTGCGATAAGTCTCTCATTT
EAM_2202 cdd -104 4.1 TTTGGTGATGCATTTCATTTAT
EAM_2202 cdd -74 4.7 TAGAGCGATTTAGATCACATAT
EAM_1320 clpS -161 4 AAATTTGAAGCAGTTAACGCTA
EAM_1320 clpS -132 4.5 TTTTGTGATAGAGGTCGCTATT
EAM_0727 coaE -75 4.4 TCGTGTGATCTGCGCCACATTA
EAM_1116 cspE -113 3.6 AAAAACGATATTTATCACTTTT
EAM_0985 cyoA -134 4 AGTTGTGACAGCGTTTGCAAAA
EAM_0455 cysQ -158 4.2 AAATGTGACACAGCACGAATAA
EAM_3380 dctA -134 4.4 TGAAGTGATTCAGCTCATAAAA
EAM_3065 deaD -99 4.8 TAATTTGAGCCGGTTCACACTT
EAM_0615 deoC -233 4.6 TGATGTGATAATTCTAACATTA
EAM_3146 dusB -219 4 TATTGTTAACTTGCTCACAAGA
EAM_2813 epd -208 4.1 TTTTGTGACGCAGATCGAAAGT
EAM_0213 fadB -164 3.6 AATTGTTATCATCTTATCACAG
EAM_0213 fadB -116 4 AGTTGTGAACCTGCCCGCAAAT
EAM_1956 fadD -130 3.9 TTTAGTGATGCGCTTCGCAACC
EAM_0507 fadH -169 3.8 AACCGTGACTGAGATCGCTAAA
EAM_2223 fruB -179 4.4 AAATGTGCTGGCTGTCAAAAAT
EAM_0417 fxsA -161 3.9 ATATCTGTTCCAGGTCACATTG
EAM_2827 galP -152 4.1 TCATGTGATCTGTCGCACAGTC
EAM_1931 gapA -215 5.4 AATTGTGATGCAGATCACCATT
EAM_3265 glpD -124 4 AGACGTTATCGGCATCACGCAT
EAM_3264 glpE -134 3.9 ATGCGTGATGCCGATAACGTCT
EAM_0119 glpF -146 4.1 TTTCATGACGCGGTACACATTT
EAM_0195 glpT -240 3.7 AAACGCGATGCGGTTAACGATG
EAM_0195 glpT -147 3.7 ATTTGTGCCTCTCTTCACGGTC
EAM_3275 gntK -129 4.6 TTTTTTGACAGTCTTCACACTT
EAM_1254 hutH -121 3.8 TTTTGTGACAAAGCTGGCACAA
EAM_0926 lacZ -94 3.8 TGTTGCGATAGCCATCACATCC
EAM_1656 lpp -56 3.6 TTGTGTAATACTTGTAACGCTA
EAM_3261 malP -54 3.9 TAAGGTGTTTGTGCTCACCTTT
EAM_1147 nagB -195 4.9 ATATGTGATTAAAGTCACCTTA
EAM_1148 nagE -161 4.8 TAAGGTGACTTTAATCACATAT
EAM_1473 ndh -55 3.7 TAAGGTTATTTTATTAACCTTT
EAM_3229 ppiA -153 5 TAACGTGATCTAAATCACTTTT
EAM_1466 ptsG -162 4.6 AAACGTGATAGCCATCAAACAA
EAM_1294 sdaC -300 3.6 ATTTGTTAAAAATCGCAAAAAA
EAM_1294 sdaC -180 3.9 AAATGTGATTCCGATCACCGGC
EAM_1168 sdhC -249 4.4 AAGTGTGATTTTTGTCACTGTT
EAM_1168 sdhC -190 3.6 TAATGAGATTGTGATCCACTTA
EAM_0744 araT -128 5.3 AATTGTTATCTGCTTCACATTA
EAM_0469 CKO_03591 -156 3.8 TGATGTGAGTTGTCTCGCTTTG
EAM_2589 tsx -218 5.3 ATTTGTGATAAAAATCACACTT
EAM_0200 udp -143 4.6 AATTGCGACTTGTATCACCTTT
EAM_0200 udp -90 4 ATTAAGGATGTTCATCACATAA
EAM_1217 ybhK -92 4.3 TATTTTGATATATAGCGAATTT
EAM_1899 ychE -158 3.8 AAAGATGATGCAGATCATCAAT
EAM_1581 ychH -97 3.9 AAATGTGATCGCTGACTCATCA
EAM_1665 ydhD -145 3.9 AAATGTTATTTTGTTATCATCT
EAM_1930 msrB -137 5.2 AATGGTGATCTGCATCACAATT
EAM_2233 yejG -177 3.6 AAATGAGCATTACTTCTCAAAA
EAM_2300 yfbV -44 4 TTGTGTGTTTTTTTTAAAATTT
EAM_2384 yfeR -33 3.7 TTAATTTATTGAATTCATATAT
EAM_2617 raiA -83 5.2 AAATGTGATTTCAATCACGATT
EAM_1104 ygbI -238 4.5 ATTAGTGATAAACTTCACATCA
EAM_1106 ygbJ -90 4.4 TGATGTGAAGTTTATCACTAAT
EAM_3109 mtgA -38 3.6 GATTTTTACGCAGATCGCAATT
EAM_3376 yhjE -134 3.6 AAATATGCCGTATTGAACATTA
EAM_1710 mlc -143 4.9 TTATGTGCTGTAAATCACATTC
EAM_0138 argB -121 3.5 AATAGTGAATAAAAATACAATA
EAM_3285 ugpB -171 3.9 GTGTGTGATGCCGTTAACACAG
EAM_1900 adhE -223 3.9 ATTGATGATCTGCATCATCTTT
EAM_0995 hupB -213 3.2 AATAGCGATTTAAGGCAAACTC
EAM_2208 galS -110 3.4 GGCTGTGAGGTTTCTCACGTAG
EAM_2465 guaB -174 4.6 ACATGTGATGAAGATCAAACTT
EAM_2496 csiE -103 3.4 TTTTGTGACCTGCCTTAAAAGC
EAM_2679 rpoS -258 4.1 TAATTTGATTATCATCAAGCAT
EAM_3417 mtlD -95 3.2 CGTTTTGATCGTGATCCCTCAA
EAM_3416 mtlA -210 3.9 CTTCGTGACTCATGTCACTAAA
EAM_3416 mtlA -229 3.3 CATTGCGAATATCTTTACACTT
Yersinia pestis KIM
y4087 mtlA -223 4.6 AGATGTGATCTTAATCAACAAA
y3875 gntT -217 4 TATGTTGATCTCTATCTCAGAA
y3945 nirB -75 3.7 CAAATTGATTTACATCAAGAAA
y3956 crp -309 3 AATTTAGACTACCCTTTCATTT
y0766 pdhR -139 3.3 TTTCATGATTTCGGTCAAGGTC
y0766 pdhR -151 4.2 AAATGTGCTGGGTTTCATGATT
y0771 acnB -276 4.3 TTATGTGAACGAATTAACACTG
y0766 pdhR -74 3.4 TTTTGAAATTGGTATTACCAAT
y0180 aaeR -55 5.1 ATGTGTGATCTAAATCACTTTT
y0510 acs -97 4.2 ATACGTGATCTGCCGCCCAAAA
y2095 araB -146 4.3 ACTTTTGACTGACATCACAAAA
y2096 araF -283 4.3 TTTTGTGATGTCAGTCAAAAGT
y0309 argE -223 3.6 TATTTTTATTTATGTCAATAAA
y3303 iciA -249 3.7 TAATTCTAGCGAGATCACAGTT
y0667 argR -300 4 ATTAATGAGATAGCGCACATTA
y1928 aroH -64 4.3 TATTGTGATCGCCATCACTTCC
y0606 aspA -224 4.6 AAGTGTGAGAGCAATCACAGAT
y4142 atpI -263 5.4 TTATGTGATGTATTTCACGTTT
y2657 cdd -75 5 TAATGAGATATAAATCACAATT
y1251 chbB -214 4.5 TTTTGCGATAACCATCACATTG
y0757 coaE -259 3.8 AAATGTGATCGGGCGTAAAACA
y0653 cpdB -148 3.6 AACTGTGAGCGTCTACGCGTTA
y0653 cpdB -116 3.8 TTTTCTGCCAAACTTCACACTT
y0653 cpdB -63 4.4 TTTTGCGATACATATCGAATAT
y2447 cycA2 -199 4.5 CACTGTGATGTACTTAACAAAA
y2447 cycA2 -118 3.7 TAATATTAAATTATTCGCAAAT
y1021 cyoA -137 4.5 ATCTGTGACCCCCTTAACATAA
y0297 cytR -177 3.7 TTCTGCGAGCCAGTTCGAAAAA
y0297 cytR -135 3.6 TTATGCAAATTAGGTAACAAAT
y0696 deaD -96 4.8 TAATTTGAGCCGGTTCACACTT
y3743 deoC -169 3.7 TGCGGTGAGATGGATCTCAATT
y3826 dppB -211 3.9 AGATGTGAGCCATATAACCTCT
y0213 dusB -57 4.3 TAACGTGATGTTATTTATAATT
y3309 epd -216 3.7 AATTGTGCCCTTTTTCAGGGAA
y0464 fadB -149 3.9 AAATATGATAAAGATCAATTAG
y0464 fadB -116 3.7 GATTGTGATCTTCACTGCAAAA
y2236 fadD -80 4.1 AATAGTGATGTATATCTCAACC
y2235 rnd -73 3.7 TGTTGTGTTTGTTATCGAACTA
y3589 fadH -131 4 ATTCATGACGGCTATCACAATC
y2177 fadR -113 3.8 CTTTATGACTGCTTTCACCATT
y2789 focA -84 4 CAATATGATCCATATCAATTTT
y2887 fruB -178 4.1 AAATGTGCGGAATGTCAAAAAT
y3777 frwC -258 4.5 AATTGGGATATTGCTCACAAAG
y0607 fxsA -245 4.8 ATCTGTGATTGCTCTCACACTT
y3043 galE2 -163 3.7 TTATTTGTCTATGCTCACAGAA
y2165 gapA -218 5.1 AAATGTGATAAAAATCGCAAAT
y3231 CKO_02295 -299 5.4 TAATGTGACTTTGTTCACATTA
y3231 CKO_02295 -122 3.8 TTCTTTGAAAGAATTCTCATAA
y3231 CKO_02295 -21 4.9 TAATTTGAGGGAGATCACAAAA
y1505 glk -113 4.7 TTATGAGATGTCAGTCACAAAA
y0404 glpA -231 3.6 AATTGTTACCTATTTTATGAAA
y0404 glpA -155 4.4 ACCTGTGATTTTGATCACAATC
y3891 glpD -129 4.4 AAATGTTACCTCCATCACGCAT
y0046 glpF -139 4 TTTCATGACGAATAACACATAT
y1189 glnH2 -268 3.8 TGGTGCGATTCGTGTCTCAAAA
y0106 gltS -148 3.8 ATTTTTTTGCTAACTCACATTT
y2629 gnd -78 3.8 AGTTGTGCTATCTATCGCACCA
y2629 gnd -76 3.6 TTGTGCTATCTATCGCACCAAT
y2547 hpaG -86 4.8 AATTGTTATCAAGATCACGAAT
y2548 hpaR -253 5 ATTCGTGATCTTGATAACAATT
y4038 hutU -261 4.9 ATATGTGATTTGGTGCGCAAAT
y3231 CKO_02295 -299 5.4 TAATGTGACTTTGTTCACATTA
y3231 CKO_02295 -122 3.8 TTCTTTGAAAGAATTCTCATAA
y3231 CKO_02295 -21 4.9 TAATTTGAGGGAGATCACAAAA
y1817 lacZ -168 4 ACATGTGCGACAGATCACATTC
y1449 maeB -92 3.7 GATTGTGATAAATCACTCACTA
y0028 malE -286 4.2 TATTGTGCCTAACACCACAAAA
y0028 malE -257 4 CAGTGTTAACTGAGTCACAATA
y3901 malP -137 4.1 TAAGTTGCTACGGATCACAATT
y3900 malT -202 4.6 AATTGTGATCCGTAGCAACTTA
y2551 manX -231 3.9 ATAGATGAGCAATGTCACATAA
y2662 mglB -212 4.4 ATCTGTGAGAAAATTCACAGTT
y1202 nagB -214 5.1 TTTTGTGATAAATATCACCAAA
y1203 nagE -206 4.9 TTTGGTGATATTTATCACAAAA
y1777 ndh -152 3.8 AAAGTTGATATATATCAATTTT
y3704 nhaA -147 4.1 AAATGTGATATGCGTTATCAAT
y3923 nudE -247 4.5 CAATGTGATCAAGTTCTAATAT
y1499 nupC -136 4.4 TTATGTGATCAAGCCCACTAAT
y1499 nupC -84 3.9 ATTTGTGGTTCACATCTCTTTT
y3744 nupC2 -154 3.8 CTTTGTCAATAACCTCACATAT
y3744 nupC2 -115 5.5 TAATGTGATTATGATCACATTT
y2044 ompW -69 3.9 AGATGTGATCTCGATTAGATCA
y3918 pck -130 4.2 ATTCGTGTTCCATCTCTCATAA
y3918 pck -80 3.8 ATATTTGATAGCTATCGCTGTT
y1791 pepT -27 3.7 ATATTTGATCATGATCACTTCC
y0400 pldB -144 4.8 AGTTGTGCTATGGCTCACAAAA
y3951 ppiA -247 4.5 AAATGAGATATTTCTCGCAAAA
y3951 ppiA -81 3.6 AAATGTGCATTCTGTTACGTAA
y2074 fsaB -103 4.3 TATTTTGATAAGAATAACGTTA
y1767 ptsG -166 4.4 AAACGTGACGGCAATCAAACAT
y0587 rhaB -234 4.2 AACTGTGAGCTGTTTCACTTTC
y0590 rhaS -214 3.9 GAAAGTGAAACAGCTCACAGTT
y2862 sdaC -286 4.3 AATTGAGATCACGATCACGGTA
y3071 sdhC -254 4.5 AATCGTGATCCTAATCACTGTT
y3301 serA -126 4.8 TTTGGTGATATATATCACATTC
y2908 spr -128 3.7 GAATGTGCGTTCATGCACATTT
y1619 CKO_00488 -208 5.4 TAATGTGATCTGGATCTCAATT
y1619 CKO_00488 -158 4.6 ATTTGTGATAGCGCTATCATTT
y2145 tdk -208 4.9 TATTGTGAGATTGCTCATATAA
y1043 tesB -153 3.6 TAGCGTGCTAATTATAGCATAA
y0444 udp -149 5.4 ATGTGTGATTTAAATCACAATT
y0444 udp -97 4 CAAGGTGACATAAATCACGAAA
y3859 uspA3 -151 3.6 ATTAGTGATCATTGTCAAAACC
y3600 uxaC -229 4.1 AAAGTTGAGTGACATCACAAAA
y3600 uxaC -109 3.6 TTTTGCGATCAATATCTATAAA
y4057 xylA -220 4.6 TTATGAGATCTACACCACAATT
y4056 xylF -264 4.8 AATTGTGGTGTAGATCTCATAA
y4056 xylF -160 4.2 AAACATGATCGTTATCATAAAA
y0949 yafK -217 3.7 TTATTTTATACAAAACATATAT
y1174 ybeD -146 4.2 TATTGTGATTAATCTTATATTG
y2677 ybiT -295 3.9 TATCGTTATACCCGTCATACTT
y3024 ybhK -227 3.8 TATTGTTATTCAGCTTACTGAA
y2296 ychH -145 3.9 AGTTGTGATCGCTACCGCAACA
y2013 ydgD -160 3.6 TTTTTTTATTTATAGCACGAAC
y1878 tcyP -166 3.6 TGATTTGATTTAATACAAATCA
y2164 msrB -85 5.1 ATTTGCGATTTTTATCACATTT
y2245 hexR -152 3.7 AAATTAGACACAGGTCATATTA
y2914 yejG -238 4.4 AAATGGGATCTGAATCCCAAAT
y2952 ygbK -73 3.9 ATTTGTGATAACAGTCATCTCA
y0179 yhcR -269 5.2 AAAAGTGATTTAGATCACACAT
y0107 uraA1 -60 4 AAATGTGAGTTAGCAAAAAAAT
y4109 yidA -57 4.1 ATTTGTGTGCTGAATCGCGTTA
y2110 mlc -146 4.8 TTATGTGCAGCAAATCACATAA
y1970 yohC -64 3.8 TTATATGATATGGACAATAAAA
y2654 yohJ -32 4.7 TAGTGTGATGGGTAGCACAGAA
y3302 rpiA -114 4.2 AACTGTGATCTCGCTAGAATTA
y3922 igaA -186 3.7 TATTGTGACTGCGTTAGCTTTG
y0328 ytfQ -229 3.8 TGGTGTGACGCCGCTCATTATT
y2244 zwf -231 4.1 TAATATGACCTGTGTCTAATTT
y0310 argC -43 3.7 TTTATTGACATAAATAAAAATA
y0015 aceB -254 3.3 ATGAGTTATAGCCATTAAAAAT
y0434 ugpB -41 4.1 TTTTTTGATGTGAGCCACACAG
y0434 ugpB -72 3.5 AAAACTGATTTATTTCGCTCAT
y0435 ugpA -197 3.4 CGATGCGCTGCCCATAACAAAA
y0499 hupA -181 3.4 AAACGTGATTTAACGCCTGATT
y0382 cyaA -151 4 AGGTGTTAGATTGATCACGTTT
y2023 adhE -286 5.3 TTTTGTGATTTAAATCACGAAA
y3875 gntT -147 4.1 TATCATGATACCGGTAACAAAT
y1030 hupB -222 3.4 AATAGTGACGGATCGCAAGAAG
y0761 ppdD -123 3.8 TTACGTTATTGCAATAACCTAA
y0769 lpdA -253 3.3 ATTGGTGATCTTGTTATTACTG
y3875 gntT -123 4.6 AGATGTGACTTTTATCACAACA
y2784 serC -39 3.3 TATAACGATGGCAATCTCAGTA
y1362 guaB -89 4.8 ACATGTGACCTGGATCAAATTT
y1328 csiE -161 4.1 TAATGTAACACATAGCGCATTA
y0834 rpoS -262 3.4 TAATCTAATCATCATCAAACAC
y4087 mtlA -179 4.5 TTGTGTGACTTTCGTCACGAAA
Serratia proteamaculans 568
Spro_4579 yhfA -280 3.3 GGTTTTGAGGCGTGTCATAAAT
Spro_4651 gntT -147 3.7 TGCGGTGATATTGATCGCGATA
Spro_4580 crp -121 3.5 ATTTATGACACGCCTCAAAACC
Spro_3381 fadL -271 5.1 TTAAGTGATGGAAATCACAAAT
Spro_3381 fadL -196 3.8 TTTTGTTAGCCAGATCTCTCTT
Spro_4012 pdhR -132 3.1 AAATGTGCGGGTAACCTGATTT
Spro_4012 pdhR -56 3.4 TTTTGAAATTGGTATTACCAAT
Spro_4008 acnB -192 3.9 TTATGTGAACGAATTAACAACC
Spro_1098 hupB -188 4.1 AATAGTGATGTATCGCAAAAAC
Spro_4393 aaeR -37 4.9 ATCTGTGATCTAAATCACTTTT
Spro_3316 ackA -125 3.8 TCACATGATGTTAATCATAAAT
Spro_0297 acs -97 4 TTGCGTGATCTGCCGCCCAAAA
Spro_2704 adhE -278 5.1 TTTTATGATTTAAATCACAAAA
Spro_2244 araB -132 3.9 ACTTATGACAGCCGTCACAAAA
Spro_2245 araF -251 3.8 TTTTGTGACGGCTGTCATAAGT
Spro_4782 argE -71 4.3 TATTGTATTTTTATTCACAATA
Spro_2172 aroH -135 3.9 TTTTGTGCTTTTTTTAGCGATT
Spro_2172 aroH -64 4.3 TATTGTGATCGCCATCACTTCC
Spro_0576 ascF -189 4.4 AAAAGTGACCACCATCACGAAA
Spro_0406 aspA -205 4.7 AAACGTGAATGAGATCACAGAA
Spro_0001 atpI -265 4.4 TATTGTGAGCAACTACACGTTT
Spro_1568 cdd -127 4.1 ACTTGCGATACATCTCGCAATT
Spro_1568 cdd -77 4.5 TAAAGAGATTTACATCACACTT
Spro_0834 chbB -177 4.6 ATTTGCGAGACAGATCACACTA
Spro_0834 chbB -143 3.6 AAATGTGAAGAGGGTCAATCAG
Spro_3731 citA -272 4.6 TGCTGTGATTTTGTTCAAAATA
Spro_0060 CKO_05006 -110 3.9 GTTCGTGACTGCGATCATATTT
Spro_1673 clpS -176 3.6 AAGTTTGAAGCAGGTAACGCTA
Spro_0774 coaE -158 3.8 CAGTGTGACCGCCCGCTCATTT
Spro_0453 cpdB -95 3.8 TTTTCTGCCACACTTCACAGTT
Spro_0680 creA -75 3.8 TTCTGTGACCTAAAACATAAAC
Spro_1672 cspD -205 4 TAGCGTTACCTGCTTCAAACTT
Spro_1672 cspD -49 3.9 TTCAGTTATTCATCTCACCTAA
Spro_1271 cydA -300 3.7 AAGTCTAACCCACATCACGTAA
Spro_1090 cyoA -135 4.2 ATCTGTGACCCCCTTAACAGAA
Spro_0454 cysQ -180 3.7 AACTGTGAAGTGTGGCAGAAAA
Spro_2746 dadA -113 4.6 AATTGTGAATGTTGTCACGTTT
Spro_0495 deaD -96 4.8 TAATTTGAGCCGGTTCACACTT
Spro_0660 deoC -262 4.6 ATTTGTGAACGATATCGCGTTA
Spro_0660 deoC -240 5.5 TTTTGTGATGGTCTTCACATAT
Spro_0660 deoC -188 3.8 TAGTGTGACTGTGAACGCGAAT
Spro_0041 dgoR -103 4.2 TTTTGTGATCTTGATTGTAGTA
Spro_0138 dppA -271 3.8 TTGTTTGCTGTTTCTCACAGTC
Spro_2451 dsdC -76 3.6 TTTAGCGACATGGGTCAACTTT
Spro_2515 dsdA -123 3.7 TAAATTGACGAGCATCATCTTT
Spro_4322 exuT -180 4.8 TTTTGTGATATCACTCAACTTT
Spro_2760 fadD -99 3.9 ATTAGTGACGTACATCGCAACC
Spro_4309 fadH -126 4.2 ATTCATGACATCTATCACATTC
Spro_3230 fruB -177 4 AAGTGTGCGTGAGGTCAAAAAT
Spro_1146 fsr -100 4.7 TTTTGCGATGTGCGTCAAATTA
Spro_0407 fxsA -117 4.9 TTCTGTGATCTCATTCACGTTT
Spro_1292 galT -143 4 TTTTTCGCTCTGGATCACCTTT
Spro_1160 galP -276 4.5 TGGTGTGATATCGGTTACATTT
Spro_1160 galP -100 3.6 TTGTGTAATCGTTTCCACTAAT
Spro_1160 galP -82 4.6 TAATGTGATCGCACTCACTTAC
Spro_2728 gapA -227 5.6 ATATGTGATACCGATCACATAT
Spro_3600 CKO_02295 -130 3.7 AAACGTGGTTTTTTGCAAAAAT
Spro_3600 CKO_02295 -21 4.6 AAATTTGAAGGAGATCACAGAA
Spro_3407 glk -116 4.8 TTTTGTGATCCGGATCGCTAAT
Spro_4881 glnA -267 4 GTATGTGATCCCTTTCACGGTG
Spro_0200 glpA -231 3.6 CGCTGTGATGGATGGCGCAATT
Spro_0200 glpA -138 4.9 AATCGTGATTATGATCACATTC
Spro_4642 glpD -129 3.6 AACTGTTACCTCTATCACGCCT
Spro_4797 glpF -183 4.1 TTTTATGACGAAGCACACACAT
Spro_0199 glpT -249 4.5 GAATGTGATCATAATCACGATT
Spro_4872 gltS -208 4 TTTAATGATTTGACCCACAAAA
Spro_1608 gnd -297 3.7 ATGCTTGAAGTGGCTCTCACTT
Spro_1608 gnd -72 4.2 ACATGTGTGCCACATCACAAAA
Spro_4497 gntK -144 4.3 AAACTTGAAGCCGATCACAGAT
Spro_0178 hemC -223 4.2 AAACGTGATCAATCTAACACCT
Spro_2706 hns -290 3.8 TCGCGTGATTTAACCCACAGAA
Spro_2706 hns -260 4.3 AATATTGATATAAAACACAATT
Spro_0625 hpaG -123 5 TTTTGTTATCACGATCACAAAT
Spro_0624 hpaR -224 5.2 ATTTGTGATCGTGATAACAAAA
Spro_0805 hutU -196 4.8 TATTGTGATTTGACGCGCAAAA
Spro_3600 CKO_02295 -130 3.7 AAACGTGGTTTTTTGCAAAAAT
Spro_3600 CKO_02295 -21 4.6 AAATTTGAAGGAGATCACAGAA
Spro_2186 lpp -55 3.6 TTGTGTAATACTTGTAACGCTA
Spro_3472 maeB -209 3.6 CTTTGTTATCAAACTCACTATC
Spro_3472 maeB -90 4.1 GTTTGTGACGTTTCTCTCACTA
Spro_4472 malE -199 4 ATCTGTGATCTGCCTGGCAAAA
Spro_4472 malE -165 3.6 TTTTGTGTCTGACGCCACAGAA
Spro_4472 malE -136 4.4 CAATGTTAACTGGATCACACTA
Spro_4636 malP -139 4.4 AAAAGTGCCTGAGATCACAATT
Spro_0054 malS -163 4 CATTGTAATATAGATTAAAAAA
Spro_4637 malT -203 4 AAGTGTGATCAATAGCAATATA
Spro_1563 mglB -229 4.4 ATCTGTGAGAAAATTCACAGAT
Spro_3399 mltB -136 4.1 TTCTGTGCTGCCCGTCACGTTT
Spro_1227 nagB -194 5.3 TTTTGTGATTTACATCACCAAA
Spro_1228 nagE -162 5.1 TTTGGTGATGTAAATCACAAAA
Spro_1228 nagE -44 3.9 AAATATGATAAAGCTCATTAAA
Spro_1926 ndh -153 4.3 AAGTTTGATGTACATCAATTTT
Spro_0694 nhaA -120 4.7 AAGTGTGATATAAATCGCTTAT
Spro_4612 nudE -135 4.4 CAATGTGATCAAGATCGGATTT
Spro_3416 nupC -84 3.6 ATTTGCAATAGACCTCTCGTTT
Spro_0659 nupC2 -181 3.9 AACCGTGACGCATGTCACGTAC
Spro_1754 ompA -195 3.8 TTTTTAGAGCTTTATCACATCA
Spro_2674 ompW -135 3.8 TTTTTTGATTCAGATCAATCCT
Spro_4617 pck -80 4.1 ATATTTGATACCTATCGCGGTT
Spro_2009 pepT -188 4.1 CGTCGTGAAGAAGATCACACAT
Spro_4477 pgi -80 3.7 AAAAGAGATCATAATCACAGTC
Spro_0196 pldB -88 3.8 TTGTAAGAATTGAATCACAATA
Spro_0196 pldB -53 4.2 TCTTGTGCCAGAGGTCACATTT
Spro_4589 ppiA -181 3.9 ATGCGTGATGCAGTTGGCAAAA
Spro_2640 fsaB -88 4.7 TGATTTGATTTCGATCAAATAT
Spro_1914 ptsG -164 4.4 AAACGTGACTGTCATCAAACAT
Spro_3448 ptsH -149 3.6 TTTTTTGATCTGAAGTGCCAAA
Spro_2930 putP -211 3.9 AAATGTGACGCAGGGTAAACTT
Spro_4382 rnk -170 3.7 CTTCGTGATCGGGATCTCTTTC
Spro_4382 rnk -67 3.8 TTTTGTGCTGTTTTTCCGAATT
Spro_1263 sdhC -253 4.3 ATCCGTGATCTAAATCACTGTT
Spro_3923 serA -215 4.4 TTTGGTGACATATGTCACATTG
Spro_2083 scrT -139 4.1 TTCGGTGATTTCGATCACACTC
Spro_2083 scrT -98 4.7 TTTTGTGATTAACATCGCAATC
Spro_3569 srlA -110 4.9 AATTGTGATCTATTTAAAACAA
Spro_4014 araT -139 4.1 TTTTGCAAGCTGGCTCACAGTT
Spro_0688 talB -271 4.1 AATTGAGACTTTTCTCAGATTT
Spro_2705 tdk -203 4.3 AAATGTGATGTCAGACAGAAAT
Spro_1111 tesB -54 3.6 TGCCGTGATATTCCGCACACTG
Spro_0529 treB -124 3.8 TTTTGTGATCCTCGCCCCAAAC
Spro_0244 udp -143 5.3 TTTTGTGACTTTAATCACAAAA
Spro_0244 udp -125 3.7 AAAAGTTATGTAGATTGCATTC
Spro_0244 udp -91 4.1 CATAGTGATGGTTGTCACGAAA
Spro_1147 ushA -103 4.6 TAATTTGACGCACATCGCAAAA
Spro_4691 uspA3 -123 4 CAGTGTGATCGCCTCAACATAT
Spro_4321 uxaC -231 4.1 AAAGTTGAGTGATATCACAAAA
Spro_3238 uxuA -167 3.9 AACCGTGAAGTGGATCAACCAA
Spro_3238 uxuA -48 4.1 AATCTTGATCACCACCACAATA
Spro_0098 xylA -222 3.9 TTTTATGATGGCGGTCATGCTT
Spro_0098 xylA -129 4.6 TTATGAGATCTGTCGCACATTT
Spro_0099 xylF -259 4.4 AAATGTGCGACAGATCTCATAA
Spro_0099 xylF -166 3.7 AAGCATGACCGCCATCATAAAA
Spro_0952 yafK -136 4.2 TTTTTTTATACACAACACATAT
Spro_1330 ybiH -146 4.6 TTAAGTGACGCAGAGCACAATA
Spro_3290 ycdZ -125 4.2 TTTTGTGACAAATTCCACATCT
Spro_3290 ycdZ -96 3.6 TATCTTGTTTCTCATTACATAT
Spro_3290 ycdZ -73 4.6 TTATGTGAAATACATCACATGA
Spro_4435 ycfR -116 3.7 TTATTTGATAAAGATTATCAAA
Spro_2703 ychE -268 5.2 TTTTGTGATTTAAATCATAAAA
Spro_1985 ychH -117 4.2 ATTTGTGATCGCCTACGCAATC
Spro_3695 ydcL -38 3.8 TTATTTGCTATGCATTAAAATT
Spro_2727 msrB -143 5.7 ATATGTGATCGGTATCACATAT
Spro_3250 yejG -214 4.2 AAATGCGAGCTGAGTCGCAAAA
Spro_3250 yejG -121 4.1 GCTTGTGATGTTTTTTACATTT
Spro_3408 yfeO -249 4.7 ATTAGCGATCCGGATCACAAAA
Spro_3441 yfeR -33 3.6 TTGATTTATTTAATTCATATAT
Spro_0882 raiA -83 4.8 ATACGTGATTTTCATCACGCAT
Spro_3682 grcA -140 3.8 AAAATTGACTTTAATCAAAGAA
Spro_1493 ygbI -211 3.9 ATCAGCGATCGTTGTCACAATT
Spro_1492 ygbJ -92 4.1 AATTGTGACAACGATCGCTGAT
Spro_4341 elbB -72 3.7 ATGTGTGATGTAGATTAGTGTT
Spro_4392 yhcR -293 5.1 AAAAGTGATTTAGATCACAGAT
Spro_4392 yhcR -89 3.8 ATTTGTGGTGCGTGTCAGCTAA
Spro_2681 yhfC -82 4.3 AATTGTGAACCCGATCACTTCA
Spro_3933 yiaK -182 4.8 AAACGTGTTGTCGATCACAAAT
Spro_2355 yjcB -81 5 CAATGTGACGCAGATCACACTA
Spro_0444 yjfP -60 3.8 TAATGCTATTAAGCTCAAGTTT
Spro_2283 mlc -111 4.8 ATTTGTGCAGCAAATCACATAA
Spro_1570 yohJ -62 4.3 ATTTGTGGCGGAGGTCACAGTT
Spro_4768 ytfQ -163 4.3 TGATGTGATGCCGCTCATTATT
Spro_2410 aldB -225 3.5 CGTTGCGACATGGGACACAAAA
Spro_4781 argC -167 4 TATTGTGAATAAAAATACAATA
Spro_4503 aceB -228 3.5 TGTTGTTATGTTTATTAACCAA
Spro_1860 proP -132 5.1 TTACGTGATTCGCATCACACAA
Spro_3863 dcuB -77 3.6 GTTTGTGATCGCTATCCCTCAA
Spro_0290 hupA -181 3.4 AAACGTGATTTAACGCCTCATT
Spro_0179 cyaA -115 4 AGGTGTTAGATTGATCACGTTT
Spro_4651 gntT -243 4.2 AAGTTTGATCTCTATCCCAGAA
Spro_4651 gntT -173 3.8 TATCATGATACCGGTAACAATG
Spro_1560 folE -121 4.3 AATCTTGACCGGGTTCACGTTA
Spro_1382 ydeV -104 3.5 TTTTGCAGCACAGTTCACAAAT
Spro_4009 lpdA -246 3.6 TATGGTGATGTAATGAAAAAAG
Spro_2411 prpR -76 3.4 TTTTGTGTCCCATGTCGCAACG
Spro_3072 paaA -63 3.8 TTAGTTAACGTGATTCACATTT
Spro_3072 paaA -134 3.8 ACCTGTGAGTAACATCGCAAAA
Spro_1562 galS -84 3.5 TCCTGTGACGGGATTCACGCAG
Spro_1562 galS -135 3.4 AATTGAGATCTGGCGCAGGTAG
Spro_3071 paaN -206 4 TTTTGCGATGTTACTCACAGGT
Spro_3071 paaN -277 3.8 AAATGTGAATCACGTTAACTAA
Spro_3633 csiE -276 3.4 AAAGGTGGTGTTCATATCAATA
Spro_3596 guaB -174 4.8 ACATGTGACCCAGATCAAATTT
Spro_0832 rpoS -261 3.4 TAATCTAATCATCATCAAACAC
Spro_1973 ebgA -63 3.5 TTCTGTGAATTTTACTAAATAT
Spro_1973 ebgA -95 3.6 TTTTGTGATCCCGTCGGCATTG
Spro_0072 mtlA -151 4.5 GTTGGTGATCTGCATCACAAAA
Spro_0072 mtlA -195 5.2 AAATGTGATGTATATCACTATA
Erwinia carotovora subsp. atroseptica SCRI1043
ECA4079 nirB -186 4.2 AAGCGTGCTATAGATCTCACTT
ECA1840 gntT -297 4.6 TAGTTTGATCTCTATCTCAAAA
ECA1840 gntT -203 4.1 GGGTGTGACAAAAATCACAAAT
ECA3081 fadL -332 3.8 AATTTTTATCTTCCTTATATTT
ECA3081 fadL -262 4.9 TTTAGTGATATCAGTCACATTA
ECA0051 gdhA -234 3.6 TTTTGTTATATAACAAAAACTT
ECA3778 acnB -163 4.3 TTATGTGAACGAATTAACAATC
ECA0276 aaeR -37 5.1 TAGTGTGATCTAAATCACTTTT
ECA3039 ackA -95 4.2 AGGTATGATGTTAATCATAAAT
ECA0808 acs -203 5 TATTGTGACATACATCACTTAT
ECA0808 acs -97 4.1 TTGCGTGATCAATCGCGCAAAA
ECA0118 aldA -36 3.6 AAGTATGACGGGTATATCACTT
ECA2274 araB -133 3.9 ACCTTTGACCAGCTTCACAAAA
ECA0191 argE -65 4 TATTGTATTTTTATTCAAAATA
ECA0684 argR -172 4.4 TTATGTGACTCAGGACGCATTT
ECA2165 ascF -255 3.9 CATGGCGATCGTGGTCACATAA
ECA2165 ascF -212 3.9 TATTGAAATCGCACTCATATAT
ECA0621 aspA -272 4 ACTCGTGACTACAATCACAGTT
ECA4519 atpI -254 5 TTATGTGAGTCACATCACAGAT
ECA2389 b1821 -267 3.8 TAGTGTTGTTTGCATCATAAAT
ECA2830 cdd -130 4.6 AATTGAGATACATCTCGCATTT
ECA2830 cdd -79 4.5 TAAAGAGATTCCGATCACAATT
ECA2577 citA -104 3.9 AAACGTGTTATTGCTCACAAGT
ECA3804 yacG -53 3.9 AAACGTGTTAAGTATCAAATAG
ECA1294 cspE -113 3.9 TTTAGCGACTTTTATCACTTTT
ECA3601 cysQ -258 3.7 TAAAGTGATTATCGTCTCTAAA
ECA4362 dctA -157 3.8 TGACGTGATTCAGCTCTTGTTT
ECA0718 deaD -96 4.4 CAATTTGAGCCGGTTCACACTT
ECA0727 deoC -282 4.4 AAGTGTGAATGAATGCACAAAA
ECA4419 dgoR -164 4.2 TTTTGTGATCCAGATTGTAGTA
ECA3913 epd -194 4.1 TTTTATGACGCAGGTCACTCTT
ECA2434 CKO_01286 -58 4.3 TAGATTGATCTAAATCACAATC
ECA0644 exuT -208 4.8 TTTTGTGATATCACTCAACTTT
ECA2372 fadD -132 3.8 ATTAGTGATCGTTCTCGCAACC
ECA2372 fadD -75 3.7 TAAAATAATGTTAATAACAATA
ECA2596 focA -79 4.5 CAATATGATCCACATCAAATTT
ECA2729 fruB -180 4.1 AAATGTGCGTGATGTCAAAATT
ECA0623 fxsA -245 3.7 AACTGTGATTGTAGTCACGAGT
ECA0623 fxsA -185 3.6 AAATGTGCAAAGGCGCACCCAT
ECA1389 galE2 -72 3.7 ATTCTCGCTGTAGATCACCTTT
ECA3171 galT -154 4 TATAGTGAAACTGATTACATTG
ECA2344 gapA -235 5.8 AATTGTGATGTGTATCACATAA
ECA3578 garD -296 4.2 TAGTGCGAGGTATTTCACGAAA
ECA3578 garD -204 5.1 AAATGTGATCAAACTCACCAAA
ECA1966 CKO_02295 -21 4.8 AAAAGTGAACGGGATCACAAAA
ECA0029 glnA -265 4.2 CTTTGTGATCCCTTTCACGGTG
ECA4165 glpA -148 5.1 TTTAGTGATGCAAATCACACTT
ECA4141 glpD -144 4.3 TAATGTGACAACTATCATCATA
ECA4141 glpD -124 4.4 TATTGTTAGCTTCATCACGCAT
ECA4266 glpF -153 4.3 TTTTTTGACGCGCAACACACAT
ECA4166 glpT -253 3.7 ATGTTTGATAAAGAGCAAAAAC
ECA4166 glpT -193 4.9 AAGTGTGATTTGCATCACTAAA
ECA1966 CKO_02295 -21 4.8 AAAAGTGAACGGGATCACAAAA
ECA1490 lacZ -149 4.1 CTTTGTGATCGCTTCCACTTTA
ECA1490 lacZ -92 4.5 ATATGTTATGGAAAACACAAAT
ECA1866 lpp -56 3.6 TTGTGTAATACTTGTAACGCTA
ECA1326 nagB -180 5 TTATGTGATAAAAATCACCAAA
ECA1327 nagE -202 5 TTTGGTGATTTTTATCACATAA
ECA1815 ndh -153 4 TAAATTGATATATATCAATTTT
ECA3183 nupC -84 3.7 TTTTGCGTCCTTCCTCTCATTT
ECA3183 nupC -31 3.9 AAATTTGGCCTGCCTCATATTT
ECA0473 nupC2 -182 4.9 AATTGTGACGAAGATCACTTTT
ECA1751 ompA -200 3.9 TCTTATGACACAAATCACATCA
ECA0469 osmY -177 4.3 TGTTTTGATTTGTTTCGCCTTT
ECA4106 pck -81 4 TTTTATGATTGCTATCGCGGTT
ECA1805 ptsG -162 4.6 AAACGTGATAGCAATCAAACAT
ECA4218 putP -130 3.7 TTGTGCAACCTTGTTAACAAAT
ECA0441 rhaS -144 3.9 CGGTGTGATCCTTGCCACACTT
ECA0450 rhaT -193 3.6 TTTTGTGATCCTGCCTATATCA
ECA3158 sdaC -195 3.7 TTCTGTGATCGCCTCAATATTA
ECA1357 sdhC -265 4.7 ATTCGTGATCTAAATCACTGTT
ECA3905 serA -214 3.9 TTTGGTACTTAATATCACATTT
ECA2735 spr -159 3.9 TAATGTGCATTCTGGCACACTT
ECA3792 araT -129 4.4 ATTTGCTATATCCATCACACTT
ECA3772 CKO_00488 -246 4.5 TAATGTGATTAACATCCAAAAA
ECA3772 CKO_00488 -196 4 AACTGTGACCGGCTTAGCACAA
ECA1162 tesB -154 3.7 TAGTATGATTCAATAAACACAA
ECA3796 tsx -172 5.5 TTATGTGATTAAAATCACATAA
ECA0185 udp -197 5.1 AAAAGTGATTTAAGTCACATTT
ECA0645 uxaC -229 4.1 AAAGTTGAGTGATATCACAAAA
ECA0645 uxaC -109 3.8 TTTTGCGATCATGACCTCACAA
ECA0645 uxaC -86 3.7 TCCTGTGAGATATTGCGCATAA
ECA0097 xylA -223 4.7 TTTTTTGATGCGGGTCATATTT
ECA0097 xylA -135 4.4 TTTTGCGACACAGCGCACATTT
ECA0098 xylF -272 4.5 AAATATGACCCGCATCAAAAAA
ECA3300 cdaR -120 4.4 TTTTGTGAGTTCTTCCACAGAT
ECA3300 cdaR -102 3.6 AGATTTAACCTAATTCCCATTT
ECA3010 ybiT -41 4 TAATGCGCGCCAAATCACATTC
ECA2185 ychH -275 3.6 TAGCGTGATTATGAGAACGCTA
ECA2185 ychH -117 3.8 ATCTGTGATCCCTCCCGCAATC
ECA2410 tcyP -176 3.7 TGACGTTATCTGCTGCACCCAT
ECA2343 msrB -135 5.6 TTATGTGATACACATCACAATT
ECA2740 yejG -178 4 ATTCGTGATCAGTTTGGCATTA
ECA2740 yejG -101 3.8 TGTTGTTTTTTTGTTCACGAAA
ECA1292 yffB -138 3.7 TTCTGCAACGCAGTTCACAGTA
ECA3349 raiA -86 4 AAAAGCGATCAATCTCACGCTT
ECA3288 grcA -199 4 AAAATTGATTTAAGTCAAAGAT
ECA4325 ygbI -267 4.8 TGTGGTGATTTTTATCACATAA
ECA4327 ygbJ -92 4.5 TTATGTGATAAAAATCACCACA
ECA0316 elbB -72 3.7 ATGTGTGATGTAGATTAGTGTT
ECA0769 yhjE -222 4.7 AATTGTGTGCGATCTCACATAT
ECA4428 yidA -228 3.8 TTACGTTATACCCGTCATACTT
ECA4230 yifB -144 3.9 AATTGCGACCCATTACGCACAA
ECA1187 cstA2 -57 3.7 TATTTTTCTACAGCTAACAAAA
ECA3892 yjtD -83 3.7 AATCGTGATCGATTACACGTCC
ECA2258 mlc -226 4.4 ATATGCGCGCTAAATCACATAA
ECA2828 yohJ -69 4.5 ATTCGTGATCTGTGGCACGTAA
ECA3993 yrdA -105 3.6 TTACTCGATCCGTGTCACTTTT
ECA4235 ytfR -68 3.7 TATTGTTAGCCTACTTACCATA
ECA3790 pdhR -55 3.4 TTTTGAAATTGGTATTACCAAT
ECA3781 fepA -64 3.8 AATTTTGATGAAACTACCACAA
ECA3790 pdhR -120 3.7 ATTGGTGATTTAGCTCAAGGTC
ECA1840 gntT -227 3.4 TATCATGATACCGGTAACAAGT
ECA0192 argC -159 3.5 TATTTTGAATAAAAATACAATA
ECA4187 cyaA -118 4 AGGTGTTAAATTGATCACGTTT
ECA3991 aceB -185 3.3 TTTTTTAATTTTAATCTTCATT
ECA1533 dcuB -296 3.5 TATTGCGAGCGAGATCTTTTAT
ECA2429 ugpB -145 3.5 TATCGCGATACAGTTCATCACT
ECA1533 dcuB -247 3.5 TTAATAGATTTAGATCAAGAAA
ECA0238 hupA -197 3.3 AAACGTGATTTAAGGCCTGAAA
ECA2326 adhE -315 4.5 AAGTTCGATGTTGATCACAAAA
ECA1151 hupB -203 3.9 AATAGTGACCTGTCGCAAAAAC
ECA2594 serC -78 3.5 AAGTATGACGGGTATAAAAATG
ECA1683 trg -169 4.3 AAACGTGATCGGGATCGCATCG
ECA3209 guaB -175 4.8 CATTGTGAGCCAGATCAAATTT
ECA3530 rpoS -261 3.8 AAATCTGATAATCATCAAGCAT
ECA0087 mtlA -230 5.1 TTTTGTGAAGTAAATCACCTAT
ECA0087 mtlA -186 4.5 TTGTGTGATTTTTGTCACGTTG
Edwardsiella tarda EIB202
ETAE_2868 gadB -186 3.7 TAGCGTTATTTTTCTCATCATT
ETAE_3129 aaeR -131 4.5 ATCTGTGACGCAAATCACTTTT
ETAE_0188 acs -97 4.4 TTACGTGATCGTGCGCGCAAAA
ETAE_1508 adhE -265 5 TTTCGTGACCTTAATCACAAAA
ETAE_3469 aphA -150 5 TTTTGTGATGAATGTCACGTAT
ETAE_3469 aphA -98 3.7 AACATAGATCATGATCACATTA
ETAE_3483 argE -65 3.9 TATTGTATTTTTATTCATAATT
ETAE_2951 iciA -48 3.8 TAACGTTTTATACATAACAAAA
ETAE_2837 aroF -117 3.8 ATGTACGATATTGTTTACATAT
ETAE_1792 aroH -63 4 TATCGTGATCCCCATCACTTCC
ETAE_0311 aspA -197 4.4 ATCTGTGAGTATTATCACAGAT
ETAE_3526 atpI -297 3.7 AATCGTGAAAATATTTAAATTA
ETAE_1162 cdd -76 4.9 AAAAGTGATTATTATCACAAAT
ETAE_1836 cfa -264 4.2 AATTGTGCGCTATGTCTCACTA
ETAE_2208 clpS -164 3.8 AAGTTTGAGGCAGTTAACGCAA
ETAE_2208 clpS -144 3.6 AATTGTGCGGCAGTGCGCTTTT
ETAE_0650 coaE -272 4 AAATGTGATCATACAAACGATT
ETAE_2580 cydA -222 3.6 TATTGTTATATTTGTTATCTTT
ETAE_3434 cytR -258 4.2 AAGTGCGATCGGGATCGAAAAA
ETAE_3434 cytR -175 3.6 ATATGTGATCATATACTCATCG
ETAE_3379 dctA -155 3.6 TTATGCGTTTCAGCTCATAGAA
ETAE_0411 deaD -96 4.8 TAATTTGAGCCGGTTCACACTT
ETAE_2958 epd -233 4.9 AATTGTGATGCAATGCACGTTT
ETAE_1900 CKO_01286 -70 5 TTATGTGAGTGCTATCACAATA
ETAE_0381 fbp -150 3.9 TGCATTGATTTAGTTCACATTC
ETAE_2666 fixA -258 3.7 ATTGGTGATCTATGTATTATTT
ETAE_1336 flhD -122 4 CGTTATGCTCCATTTCACATTA
ETAE_2303 fruB -199 4.1 AAATGTGCTGAAGGTCTAAAAT
ETAE_0293 fucA -175 4.2 AGTCTTGATGACGGTCACAAAA
ETAE_0312 fxsA -189 4.6 ATCTGTGATAATACTCACAGAT
ETAE_2564 galE2 -195 3.7 TAGTGTAAGCGATACCACAAAC
ETAE_2966 galP -275 3.7 CAAAGTGAAAACGATTACATTT
ETAE_2966 galP -61 4.5 TTATGTGATCATGCGCACTTTA
ETAE_1483 gapA -227 5.1 TTTTGTGATGAGCATCACAAAC
ETAE_3493 glnA -267 4.2 GTTTGTGATCCTATTCACGATG
ETAE_3115 glpA -247 4 TACTGTGAGAGATCGCTCATAT
ETAE_3115 glpA -142 4.8 TAGAGTGATTTTGATCACATTG
ETAE_3312 glpD -124 4.3 TTGTGTTATCCGCATCGCGTAA
ETAE_3441 glpF -139 3.9 TTTTTTGACGACACACACACAT
ETAE_3116 glpT -200 3.7 ATATGAGCGATCTCTCACAGTA
ETAE_0026 gltS -199 4 TTTAATGATCTGCGCCACAAAA
ETAE_0135 gntK -142 3.9 AACTGCGAGTAGCATCACAGTT
ETAE_0527 gltB -278 4.9 AACTGTGATGCAGCCCACATTT
ETAE_0118 hemC -205 4.2 AAACGTGATCAATTTAACACCT
ETAE_1852 lpp -55 3.6 TTGTGTAATACTTGTAACGCTA
ETAE_2386 lrhA -275 3.7 TAACGTGATCTTTATCTGTCTT
ETAE_3304 malP -146 3.7 TAGCGCGGTCCCGATCACACTT
ETAE_3303 malT -212 3.8 AAATGTGATCAGCCGCAATTTC
ETAE_1559 manX -267 3.9 ATTAACGATGGGCGTCACATAA
ETAE_0715 mltA -175 4.2 TTTTTTGACAAACATCACCGAT
ETAE_2617 nagB -190 5 ATTTGTGATAACTATCACCAAT
ETAE_2616 nagE -157 4.8 ATTGGTGATAGTTATCACAAAT
ETAE_1381 nanA -141 4.5 TTTAGTGAACTAGATCGCACAA
ETAE_2070 ndh -166 4.3 TTATTTGATTTGAATCAATTTT
ETAE_3268 nudE -116 3.6 AAATATGAGCATCTGCGCACAA
ETAE_0482 nupC2 -232 4.9 TGATGTGATATGCATCACTTTT
ETAE_1267 ompA -196 3.7 TTTGGTGAGCATAATCACATCG
ETAE_1528 ompW -161 3.9 CTGATTGATGTCTATCAAATTT
ETAE_3277 pck -82 3.9 TTTTTTGATGACTATCTCGGTT
ETAE_3343 pldB -217 3.9 CGGTGTGATAATCCTCAAACTT
ETAE_0492 rnk -145 4.4 ATTTGTGAGCCAGCTCTCTTTT
ETAE_2588 sdhC -261 3.7 ATGCGTGACCGTTGTCACTGTT
ETAE_2298 spr -131 4.4 AAGTGTGTTCTGCTGCACAATT
ETAE_3025 CKO_00488 -210 4.3 TTTCGTGATAGCGCTATCATTT
ETAE_0570 talB -129 4 ATTTGTTAGCGCTTTCGCCTTT
ETAE_1506 tdk -206 4 AACTGTTAGGTCGATCACTTAT
ETAE_2935 tsx -245 4.6 TAATTTGATGAGAATCTCAATT
ETAE_0143 udp -148 4.7 TATTGTGAAAATAATCACAGTT
ETAE_1034 ushA -139 4.4 TTAGGTGAGTCACGTCACAATA
ETAE_0436 uxaC -228 3.8 AAGGTTGAGAGCTATCACAAAA
ETAE_2289 uxuA -188 4.2 AATCGTGAGGCGGATCAACCAA
ETAE_2518 ybiT -40 4.8 TAATGTGAACAAAATCACGTTA
ETAE_2360 ycdZ -124 4.3 AAGTGTGATTGATGTCACTTTG
ETAE_2360 ycdZ -72 3.6 CGGTGTGATGTCCATCAATGAA
ETAE_1484 msrB -91 4.9 GTTTGTGATGCTCATCACAAAA
ETAE_2046 yecF -110 3.8 TTTTGTGATATACTCCGCTATC
ETAE_2396 yfbV -34 3.6 TTTTTTAACTCTTATCGAATAA
ETAE_2834 raiA -82 3.8 ATCCGTGATTTTCCTCTCACAC
ETAE_1921 ygbI -132 3.9 AACCGTGTTTATCCTCACAAAT
ETAE_1922 ygbJ -93 3.9 ATTTGTGAGGATAAACACGGTT
ETAE_0025 uraA1 -56 3.7 TTTTGTGGCGCAGATCATTAAA
ETAE_0032 yicG -180 3.8 AAAACTAATCTATATCAAATAT
ETAE_0086 yifB -128 3.7 TATTGTTAATGTGTTAATAATT
ETAE_1713 mlc -113 4.8 ATTTGTGCACTTAATCACATAA
ETAE_1164 yohJ -68 4.9 TGATGTGATCAGTAGCACATTT
ETAE_2950 rpiA -276 4 TTTTGTTATGTATAAAACGTTA
ETAE_3192 yrdA -235 4.1 TCCTGTGATGTTGTTCACATGT
ETAE_0658 pdhR -143 3.2 TTTCATGATTTACATCAATAGT
ETAE_3482 argC -160 3.4 AATTATGAATAAAAATACAATA
ETAE_2844 dcuB -194 3.6 ATACTTTATTCAGATCAATTTT
ETAE_3321 ugpB -63 3.4 CAATATGTTGTTTATCACTCAA
ETAE_0183 hupA -182 3.3 AAACGTGATTTAACACCTGATT
ETAE_0119 cyaA -119 4 AGGTGTTAAATTGATCACGTTT
ETAE_0844 tnaC -231 4.1 ACGCGTGAATTCCATCACAATT
ETAE_3292 ulaA -138 4.5 AGTTGAGATCATAATCACAAAT
ETAE_0995 hupB -221 4.4 AATAGTGATATATCGCAAAATA
ETAE_2177 aroA -104 3.8 TATAGTGACAGCGCTCAATAAA
ETAE_2787 guaB -175 4.7 TCATGTGACCTAGATCAAACTT
ETAE_2873 rpoS -54 3.5 TAGTTTGAGCAGGATCGCTGTA
Proteus mirabilis HI4320
PMI2820 crp -135 3.3 TATTATAATCTATTCCTTATTA
PMI1810 fadL -326 3.7 AAGTGTTAATTATCTATCATAA
PMI1810 fadL -186 4.2 TAATGTTAACTAAATCCCAAAT
PMI2047 pdhR -158 3 ATTTGTTAAAATTTGCAGGTTT
PMI2040 acnB -177 4.5 TTATGTGAACGAATTAACATAG
PMI2047 pdhR -199 4.4 TAATGCGATCTAGTTATCAAAT
PMI2047 pdhR -181 4.2 AAATTTGATGAATTTATCAAAT
PMI2047 pdhR -218 3.1 TGTTTTTAATCTTTTCTAATAA
PMI0118 hupB -216 4.9 AATCGTGATGTGAATCATAATA
PMI1771 ackA -123 3.6 AAGCATGATGCGTATCATTAAT
PMI3037 acs -97 4.5 TTTCGTGATCTTATGCGCAAAA
PMI1486 adhE -246 5.4 TATTGTGATGTAGATCACTTTA
PMI1486 adhE -187 3.7 AAAGGAGATCTTTTTAAAATAT
PMI0708 ansB -81 3.6 ATTCGTTCTATTTATCACGGAA
PMI0729 aphA -148 4.3 AAGTGTTAGATAGATCAAAAAA
PMI0729 aphA -87 4.3 TAACGTGCGCTATATCTCATTT
PMI0729 aphA -34 4.3 TTCTGTGATTAATATAAAAATT
PMI3236 argE -65 3.9 TAATGTATTTTTATTCAAAAAA
PMI3399 argR -267 3.6 TTTTGAGAAATAATTCCAATAA
PMI3399 argR -129 4.2 TTTTTTGAGTTAACACACAAAA
PMI0387 aroF -214 4.5 TTATTTTATCTTAGTCACATTT
PMI1423 aroH -55 3.9 TATTGTGATCTTAATCACTGGG
PMI2546 aspA -206 4.1 ATCCATGAGATAGATCACAAAA
PMI3057 atpI -259 5 TTGTGTGTTCTAGATCACATTA
PMI1608 b1821 -272 3.8 AATTATTATCAATATCATCTTT
PMI1608 b1821 -237 3.9 TAATATGTTGCCTTTCATAAAT
PMI2667 bax -233 4.2 AAATTTGAGTTAAATAGCATTA
PMI2654 caiT -209 4.5 TAGTGTGAAGTGAATAACAGAA
PMI0643 cdd -132 4.4 ATTTGAGATGTATCTCCCAATT
PMI0643 cdd -82 5.1 AAATATGATTTTAATCACATAT
PMI0689 clpS -268 3.7 TGTCTTTATTTACTTAACATTA
PMI0689 clpS -148 4.1 AACTTTGATGTAGCTAACGCTT
PMI2052 coaE -80 3.8 TCTTGTGATAAAAATCAGTTTA
PMI0688 cspD -163 3.8 AAGCGTTAGCTACATCAAAGTT
PMI1614 cycA2 -102 4.4 TTCTGAGATTTGTGTCACAATA
PMI0573 cydA -247 3.8 AAATATGCTGTTACTAACCTAA
PMI0108 cyoA -194 3.6 AAATTATAGTTAATTCACAATA
PMI0108 cyoA -147 3.6 TTAATTACTTGTGATCACATTA
PMI0108 cyoA -141 4.3 ACTTGTGATCACATTAACACAA
PMI3218 cytR -207 4.3 TTTTGCGAACTACCTCATAAAA
PMI3218 cytR -189 3.9 AAAAACGATTGGTATCACACTT
PMI1509 dadA -121 4.7 AAATGTGATTTGACTCTAAAAT
PMI3424 deaD -80 5 TAATTTGAGCCAGTTCACATTT
PMI2416 deoC -267 4.4 ATATGTGAGTTACTTCGCAACT
PMI2416 deoC -135 5.6 TTTTGTGATTCTGATCACAATT
PMI2416 deoC -83 4.5 TATTGTGACAGAAAGCACATCT
PMI0184 dsdC -199 3.6 TATTGTTAAACATATTGAATAT
PMI0184 dsdC -117 4.4 ATAGGTGATCAGATGCACAAAT
PMI0186 dsdX -126 4.4 ATTTGTGCATCTGATCACCTAT
PMI0186 dsdX -44 3.6 ATATTCAATATGTTTAACAATA
PMI3623 dusB -94 3.8 TTTCGCGATTTGGTTAAACTTT
PMI0241 epd -253 4.4 AAATGTTAACAAGAGCACATTT
PMI3550 fadB -109 4.1 CATTGTGATCAGCCCTACATTT
PMI1166 fadD -121 4.4 TTTAGTGATACACTTCGCATCT
PMI3702 fadH -213 3.8 TATTATTATATGATTAAAAAAT
PMI3702 fadH -103 3.8 TTCCATGATTAAGATCACAACT
PMI1510 fadR -111 4.4 TTTTATGATGCCATTCACTATT
PMI1510 fadR -84 3.8 ATGGTTGAGCTATATCAAAATT
PMI2202 fdrA -191 4.2 AACTGTGACTTTAATCACTCTA
PMI2653 fixA -216 4.3 ATTGTTGATCCAGATAACAATA
PMI2653 fixA -157 4.3 ATTGGTGATGTATTTAGCAATA
PMI2653 fixA -98 4 ATTGGTGATCTAGATTTAATTT
PMI1672 flhD -158 3.6 TGAAATGATCGTAATCAAGTAA
PMI0706 focA -188 4 TTTTTTGATAAAATTTAAAAAA
PMI2157 fruK -254 4.6 AAACGTGATTTAGATCTAACTT
PMI2545 fxsA -188 4.7 TTTTGTGATCTATCTCATGGAT
PMI1504 gapA -226 5.6 AAATGTGATACATTTCACATAA
PMI2882 glnA -270 4.7 AATTGTGATCCTTTTCACGCCT
PMI2882 glnA -215 3.8 AATTGTGCAACTATTCAGACTT
PMI2882 glnA -181 3.9 ATTTGTGCAATAATTAAAAAAT
PMI3592 glpA -262 3.7 TACTGTGAAGTAATACTCAGTT
PMI3592 glpA -170 5.5 ATTTGTGATTAGTATCACATAT
PMI2930 glpD -129 4.4 AATTGTTATTTATATCACGCAG
PMI2929 glpR2 -32 3.8 TAACATGATATTTTTAACTTTA
PMI3211 glpF -132 4 TTTCATGATGGGACACACAAAA
PMI3591 glpT -291 3.6 ATGTTTGATAATGAGCAAAAAC
PMI3591 glpT -232 5.4 ATATGTGATACTAATCACAAAT
PMI0437 glnH2 -142 4 TATTGAGAGATAGCTCTCGTAT
PMI2867 gltS -210 4 TTTAATGATCTGCGCCACAAAA
PMI1867 glyA -210 3.8 TAGCGAGATGTGCCTCAAAAAG
PMI0655 gnd -71 4.7 CTATGTGATCAGGTTAACAAAT
PMI2673 gntK -137 4.5 ATTTGCGAGACGCTTCACACTT
PMI0160 hpt -154 3.6 TACTGTAATAAGTAACAAAATT
PMI1409 lpp -200 4.4 TTTTGTGAAATAACACGCATTT
PMI1764 lrhA -272 4.1 TTGTATGATCTACATCTAACTT
PMI1764 lrhA -202 3.7 AAATTTAATTTGTTACAAAAAA
PMI1764 lrhA -40 3.7 ATATGTAATTTAAAAATCAAAA
PMI0454 nagB -217 4.9 ATTTGTGATTAAAGTCACCTAT
PMI0455 nagE -150 4.6 ATAGGTGACTTTAATCACAAAT
PMI0875 ndh -157 4.6 TTTTTTGATATAAATCAACTTT
PMI0011 nhaA -110 3.9 ATAAGCGATTGAGATCGAAAAA
PMI1822 nupC -132 3.9 AAGTGTGATCAACCTATCTTAT
PMI1822 nupC -80 4.4 TATTGTGACAATAATCACATCG
PMI1822 nupC -58 3.8 TAATGTTACGCGTTACATAAAA
PMI2418 nupC2 -180 5.2 TAGTGTGATTTAGATCTCATTT
PMI1350 ompW -168 4.6 AAATTTGATGTGGATCAATTAT
PMI1350 ompW -85 3.8 AGTTGTGATCGGCATTAGATCA
PMI3015 pck -131 4 ATTTGTGCATTAGTTCTCGTTA
PMI2754 pgi -245 3.7 CAGTGAGATGTTAAACACAGTT
PMI2292 ptsG -156 4.5 AAACGTGACAGCTATCATATAT
PMI1828 ptsH -275 4.4 TTTTGTGGTAGAGATCAAACTT
PMI1828 ptsH -115 3.6 TAACGTAACATGGCTTATATTA
PMI1615 putP -220 3.8 TAGTGTGAAGTTACATACAAAA
PMI0672 sdaC -283 4.3 ATTTGAGATGGTGATCACGGTA
PMI0565 sdhC -264 4.3 AAAAGTGATCCCTCTCACTGTT
PMI2031 serA -210 4 TTCAGTGATATATATCACACGA
PMI3036 sodA -292 3.7 TTTTGCGCATAAGATCACGAAA
PMI0831 spr -129 4.2 TTACGTGCTTTAGAGCACGTTT
PMI0850 scrT -223 3.7 AAACGTGAAATATCTAATGAAT
PMI0850 scrT -141 4.4 AATAGCGATCTATCGCACATAA
PMI0850 scrT -100 4.4 TTTAGTGCGTTAAATCACATAA
PMI1778 CKO_00488 -139 4.2 AATTGTGATAGCGCTATTATTT
PMI0006 talB -287 4.3 TATTTTGATTTAGTTCTACTAT
PMI0001 thrA -232 3.9 AAATTTGACATCTCTCTCGCTT
PMI3532 udp -145 5.1 ATTTGTGATAACTATCACGTTT
PMI3532 udp -93 3.6 ACAGGTGACGTCAATCACTAAA
PMI2177 ushA -111 3.7 ATATATAACCTACGTCATAAAA
PMI3009 uspA3 -290 3.6 AGTTGTTCGCTTTTTCAAAAAA
PMI3009 uspA3 -113 3.8 AGTTGTGATCAAGGCAACATCT
PMI1276 xylR -93 4.9 TTGTGTGATAGTAATCACATAG
PMI0351 yafK -297 3.7 AATTGTTACTATTTTCTCTTAT
PMI0351 yafK -228 3.7 TCGAGTGATTTAGCTCAAGCAA
PMI0619 ybiH -160 3.6 AATTTTTAAATAAATCATGTTT
PMI0609 ybhK -215 3.8 TTTCGTTATATAATTTATAATA
PMI0717 ycaI -212 3.6 TTACGTGATCTTTCTCTATTTG
PMI0717 ycaI -152 3.6 TTTTTAGAACAACTTCGCAAAA
PMI3124 ycdZ -240 3.7 ATTAATAATATATATCAAACAA
PMI1485 ychE -290 5.3 TAAAGTGATCTACATCACAATA
PMI0991 ydcH -276 3.6 TTTATTTATAGAATTAACAATA
PMI0991 ydcH -236 3.8 AATAGTGATGTTCGTATAAAAT
PMI0991 ydcH -114 3.6 TTACTTGATATCGCTCTTGTTT
PMI0991 ydcH -43 3.8 TAGTATGACACTCATCACTCAT
PMI1956 ydcH -41 3.7 TACTGAAATAGAGATCGCAATT
PMI1394 ydhD -292 3.6 TAATGTGCATTTATACACTTAT
PMI1503 msrB -137 5.3 TTATGTGAAATGTATCACATTT
PMI1156 hexR -58 3.6 AACCGTTATAGATTTCTCCTTT
PMI1453 yecF -202 4.3 TAGCGTGATATCGATGACATAA
PMI1770 yfbV -290 3.7 ATTAATGATACGCATCATGCTT
PMI1770 yfbV -260 3.6 AAACTTGATGCTAATTATAGTT
PMI0391 raiA -82 4.6 AAAAGTGATCTTGATCATGTTT
PMI3679 elbB -174 4.1 TTTTTTGATTATCATTACATAG
PMI2868 uraA1 -54 3.7 TTTTGTGGCGCAGATCATTAAA
PMI0142 cstA2 -279 3.6 ATTTTTTATGTAATTAATAGTT
PMI0142 cstA2 -234 5.2 ATTTGTTATCTCGATCACAAAA
PMI2509 yjjI -159 3.7 TTATTTTAGATATATCTAATTT
PMI1292 mlc -126 4.7 ATATGTGCTTTCCATCACGATT
PMI0645 yohJ -71 5.2 TATTGTGATCCATAGCACACTT
PMI2032 rpiA -96 3.8 TAAAATGTTGTGTCTCAAATTT
PMI1157 zwf -225 3.7 AAGTATGACCTGTGTCTAACTT
PMI2044 lpdA -133 3.4 GGTTGTGAGATCTGTCATGTTA
PMI3237 argC -57 3.6 TTTTTTGAATAAAAATACATTA
PMI2764 aceB -68 3.7 ATTTTTGATTTTTGTAAAAACT
PMI3230 proP -278 4.4 AGCTATGATATAGGTCACATTT
PMI0389 dcuB -138 3.3 AACTATAACAACGATCAAAAAA
PMI2771 hupA -183 3.7 AAACGTGATTTAGTGCTTGAAA
PMI3333 cyaA -130 4 AGGTGTTAAATTGATCACGTTT
PMI1478 nirD -129 3.5 TTTTGTGCACTTTATTAACAAT
PMI0639 folE -86 4.9 TAATGTGATTCAGCTCATCTAA
PMI3008 gdhA -195 3.4 AATCCTGATTTTATTAGCCTTT
PMI3008 gdhA -88 3.5 AAACAATATCAACCTCACATAA
PMI2049 ppdD -146 4.3 TAATGCGAACTTGCTCTCAATA
PMI1733 ubiG -89 3.4 TTTCGCGATTCTCTTCGATTTA
PMI1733 ubiG -214 3.5 TGGTGTGATTTCTCTGGCAATG
PMI0711 serC -119 3.5 TATTTTTGTGTGCTACACATAA
PMI1546 guaB -173 4.7 TCATGTGAGCCAGATCAAATTT
PMI2236 rpoS -63 3.2 AACTGGTAAATCGATCTCATTA
PMI2236 rpoS -216 3.2 ATAATTGCTGTTAATAACTAAT
PMI2095 metK -275 3.5 CACTGTGATTCAGTTTTCACAG
PMI2047 pdhR -89 3.1 TACTTTATTATCCATTACATTA
PMI2047 pdhR -95 3.1 CTTTGTTACTTTATTATCCATT
PMI2047 pdhR -138 3.9 TTTTATGATTTCGCTCAACAAC
Photorhabdus luminescens subsp. laumondii TTO1
plu3619 acnB -261 3.6 TTCTGTGAACGAATTAACATCG
plu3095 ackA -121 3.6 TAGCATGATGTTAATCATTTAA
plu0074 acs -98 4.2 TTGCGTGATCTTCCGCGCAAAA
plu2496 adhE -237 3.7 TATTTTTATTAGATTAAAAATT
plu2496 adhE -138 4.6 TTATGTGATTAAGATCAATATA
plu1616 ansB -76 3.8 AAGTCTGGTATGTATCACAGAT
plu4745 argE -65 3.9 TAATGTATTTTTATTCAAAAAA
plu3610 iciA -41 3.6 CATAGTGATATTCAGAAAAATA
plu1262 aroF -262 3.6 TGTTTTGATATTGATTTTATTT
plu2630 aroH -62 3.8 TATTGTAATTTCCATTATCTAT
plu4137 aspA -274 3.8 AGATATAATTGGGGTCACAGTT
plu4137 aspA -211 5.6 AATTGTGATAAATATCACATAT
plu3110 astC -66 3.8 AAAGATGATGCGGAGCATATTA
plu0047 atpI -265 5.7 TTATGTGATTTAAATCACATTT
plu2701 b1821 -281 3.9 TATTGTGCTATCTTTTAAATTG
plu2701 b1821 -179 3.7 AAACGTGGTGCGGGTAACCTTA
plu0518 yedJ -156 5.6 AAATGTGATGTGAATCACACAA
plu1547 cdd -75 4.7 CTATATGATATTTATCACATTA
plu1593 clpS -170 4.3 AAGTTTGATATAGATAACGATA
plu0561 creA -111 4 CTTTGTGAAATTATTCTAATAA
plu1592 cspD -194 4.6 TATCGTTATCTATATCAAACTT
plu1965 cycA2 -102 4.6 TATAGTAATCTGTGTCACAATA
plu4760 cytR -213 4.2 ATTTGCGAGCCATATCGAATAA
plu4760 cytR -195 4.6 ATAAATGATTTATATCACACTT
plu2561 dadA -114 5.4 AATTGTGATCTAAATCATAAAT
plu3205 dctA -176 4.9 TTATGTGATCTATATCTTAAAA
plu4523 deaD -95 5 TAATTTGAGCCAGTTCACATTT
plu0300 dppA -223 3.7 AAATGTGCGCATTGTCATGTTT
plu1968 dsdC -124 4.4 TTCAGTGATACCGATCAAAATT
plu1968 dsdC -94 4.5 ATTTGCGATTTAAATCACTAAA
plu1969 dsdX -169 4.9 TTTAGTGATTTAAATCGCAAAT
plu1969 dsdX -139 4.4 AATTTTGATCGGTATCACTGAA
plu4088 dusB -191 3.7 CTAAGTGATAAACTTTACCAAT
plu4402 fadB -133 3.8 CAGTGAGATACAAATCTCACTT
plu4402 fadB -115 3.9 ACTTGTGATCACCCTTGCAAAA
plu2134 fadD -288 3.8 AAATGCTATCTTAAGCAAAAAA
plu2134 fadD -137 4 ATTAGTGATGTGTATCTCAACC
plu3990 fadH -161 4.3 TTTCATGACCTTCATCACATTC
plu1614 focA -88 4.7 AATTATGATCTATATCAAATTC
plu1992 fruB -180 4.7 AAATGTGAGTAATCTCAAAAAA
plu2858 fruK -72 3.7 TTTAGTGATATAAATAGAACTG
plu4136 fxsA -188 5.6 ATATGTGATATTTATCACAATT
plu0575 galT -120 4.3 TTGCGTGATTGGTATCTCAGAT
plu2558 gapA -224 5.4 TATTGTGATGTGACTCGCATAT
plu0197 glpE -102 3.6 TAACGTATTACTGATAACAAAT
plu4119 glpT -250 4.9 TATTGTGACAATTGTCACAATT
plu3291 glyA -178 3.8 TAGCGTAATTTTCATTACACTA
plu1560 gnd -74 4.4 ACATGTGATCACATTAACAAAT
plu0497 gntK -136 5.5 ATTTGTGATAAATATCACATTT
plu4009 gltB -241 4 ATATTTGACCTGATTTATATTT
plu0990 hpaG -159 3.7 AATAATGATAAAAAACAAATTT
plu0990 hpaG -129 4.9 TATTGTTACTGAGATCACAATT
plu0991 hpaR -285 3.9 AATTTTAATTGTGATCTCAGTA
plu0991 hpaR -279 5 AATTGTGATCTCAGTAACAATA
plu0860 hpt -144 4 AATTCTGATATGCTTTGCAAAA
plu3193 hutU -203 4.7 ATTTGTGATTATAAACACAAAA
plu3090 lrhA -287 3.7 TTCTTTGACGTGAGTCAGAAAA
plu3090 lrhA -282 3.8 TGACGTGAGTCAGAAAACAAAA
plu3090 lrhA -73 4.2 TAATTTGATAGTGCTTACGTAA
plu2719 maeB -74 4 TGTTATGATTTGACACACAGTA
plu0458 malE -213 5.3 AATTGTGATATTTATCGCAAAA
plu0458 malE -150 4.1 TTTTGTAATAGAGATCACACCC
plu0457 malK -250 4 GGGTGTGATCTCTATTACAAAA
plu0457 malK -221 3.8 AAGCGTGCCGTTGCCCACAAAA
plu0457 malK -187 4.9 TTTTGCGATAAATATCACAATT
plu1318 nagE -200 3.7 AAATTTGAACCCGTTTACTATT
plu1318 nagE -132 3.9 TATCGCTACAGTGATCACAATT
plu2821 ndh -154 3.8 GAATTTGATGTTGTTCAATTTT
plu0587 nhaA -122 4.4 TATTGAGATGTAGATCATCAAT
plu1399 nupC -213 3.8 TAATGTGATATCTATACTCTAT
plu0519 nupC2 -178 5.5 TTGTGTGATTCACATCACATTT
plu2478 ompW -164 4.3 AACTTTGATTTGGATCAAGTTA
plu2478 ompW -39 3.8 TATTTTGATTGACTTTAAATCA
plu4248 osmY -167 3.8 GATTGTGATTCTGCTTAGATTA
plu0100 pck -86 3.8 TTTTTTGATAACTATCGCTGTT
plu4379 pgi -205 3.8 TGACGCGATGAGAATCATAAAA
plu1958 putP -243 4.4 AAATGTGATTCAGTAAACGTTT
plu4046 rnk -127 3.7 GTTCGTGATCATGATCTCTTTA
plu3605 serA -207 4.4 TTTAGTGATATATTTCATATCT
plu3605 serA -178 4.2 TTATTTGATCTAAATCCTAATT
plu3605 serA -105 4.4 TTATGTGATGGGAATAGCAATC
plu0075 sodA -297 3.7 TTTTGCGCGGAAGATCACGCAA
plu1978 CKO_00488 -195 3.8 GCTAGTGATATTAGTCACAAAT
plu1978 CKO_00488 -145 4.7 AATTGTGATAGCGCTATCATTT
plu2497 tdk -157 4.1 TGGTGTGATGGTGGTCATGAAT
plu0563 thrA -223 4.2 ATGTTTGACTTTGCGCACAAAT
plu3288 treB -127 4.3 CAATGTGATCTTCAACCCATTT
plu4417 udp -271 5.2 TTTTGTGATTTATATCTCAAAA
plu4417 udp -219 4 TGAAGTGACATTTATCACTAAA
plu2275 xylA -251 4.6 ATTTATGAGATAAATCACACAA
plu1195 yafK -232 3.9 TCAAGTGATTTAGTTCAAGCAA
plu1498 ybhK -119 3.8 ATTTGTGATCAGTTAAAACATT
plu1629 ycaI -230 3.7 ATTTGATATCAGTATCGCAATG
plu1629 ycaI -152 4.4 ATTTGCGAAGCTGTTCGCATAT
plu2495 ychE -295 4.9 TATATTGATCTTAATCACATAA
plu2065 ychH -189 4.1 AGTTGTGATCGTGTCCGCAATG
plu2557 msrB -267 4.6 ATATGCGAGTCACATCACAATA
plu2121 hexR -132 3.7 TTTTATGAAAAACATTAAATTA
plu2029 yecF -177 4 TATTCTGATTATGATAAAATTA
plu2029 yecF -132 4 ATATATGATTTTAACAACAATT
plu1559 yegH -193 3.9 ATTTGTTAATGTGATCACATGT
plu2865 yejG -185 4.1 AAATGAGAGATTGATCTCACTT
plu2865 yejG -183 3.6 ATGAGAGATTGATCTCACTTTT
plu2865 yejG -141 3.8 TAATGTAATACTATAAACACAA
plu1266 raiA -87 5.1 AATAGTGATTTAGATCACCTTT
plu2507 ygbJ -147 3.8 ATAAATAATATAAATCAAATAA
plu2507 ygbJ -90 3.7 GAATGTGATAACCATCGTGTAT
plu4686 yifB -268 3.7 TAATTTAATTTAAATTTCAAAA
plu2226 mlc -119 4.8 TTTCGTGCTGAATATCACATAT
plu2122 zwf -234 4.2 TAATTTAATGTTTTTCATAAAA
plu4744 argC -59 3.6 TTTTTTGAATAAAAATACATTA
plu4396 aceB -65 3.8 GTTTTTGATTTATTTTAAATAT
plu0492 hupA -179 3.4 AAACGTGATTTAATGCTTTAAA
plu0799 tnaA -167 3.6 TGGTTTAATGTCGATCACCGTA
plu4643 cyaA -126 4 AGGTGTTAAATTGATCACGTTT
plu3639 pulE -227 4.1 AAATGTGAATCGACAAACAATT
plu3542 prpB -129 3.6 TAATTTAAAAACAATCATATAT
plu3621 lpdA -131 3.9 TGTTGCGAGTTCTGTCACGTTA
plu3866 hupB -222 3.5 AATAGTGAATTTTTTCAATAAG
plu3639 pulE -182 3.2 ATATTTGAATTTTAATTCATTA
plu0122 gdhA -92 3.5 AAACACAACTTACCTCACATTT
plu3543 prpR -225 4 ATATATGATTGTTTTTAAATTA
plu3142 lsrR -137 4.3 AATTGTGATCTTGGCAATATTT
plu2713 guaB -176 4.4 ACATGTGAGAAAGATCAAATTT
plu3683 metK -205 3.3 GTTTATACTCGCAATCACATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD