Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Ralstonia

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia solanacearum GMI1000
RS01909 imuA -159 6.2 TACTGTATATCCATACAGTA
RSc0551 recA -180 5.5 CACTGGTTTTTTATACAGTA
RSc1304 lexA -25 5.4 ACCTGTTCAAATATACAGTG
RSc1304 lexA -44 5.3 CACTGTATAAAATCACAGCA
RS05321 uvrD -39 6 TGCTGTATATTTATACAGTT
RS00884 BPSS1334 -29 5.2 CAGTGTACGTATATACAGTC
RS00884 BPSS1334 -44 5.9 GCCTGTATATATTTACAGTG
Ralstonia pickettii 12J
Rpic_4490 imuA -44 6.4 TACTGTATATTCATACAGTA
Rpic_0471 recA -172 5.5 CACTGGTTTTTTATACAGTA
Rpic_1179 lexA -25 5.4 ACCTGTTCAAATATACAGTG
Rpic_1179 lexA -44 5.3 CACTGTATAAAATCACAGCA
Rpic_4129 uvrD -40 5.9 TGCTGTATATTCATACAGTT
Rpic_4716 BPSS1334 -26 5.3 AACTGTGAATTTATACAGTG
Rpic_4716 BPSS1334 -45 6 AACTGTATATATTCACAGTA
Ralstonia metallidurans CH34
Rmet_4128 imuA -72 6.4 TACTGTATAAACATACAGTA
Rmet_0466 recA -171 6.1 TACTGTTTTTTTATACAGTA
Rmet_1981 lexA -43 6 TACTGTTTAAACATACAGTG
Rmet_1981 lexA -63 5.4 TACTGTATAAAATCACAGCA
Rmet_0232 uvrD -66 5.6 GGCTGTATGGATATACAGTG
Rmet_1177 H16_A1352 -70 6.2 TACTGTACATTCATACAGTA
Rmet_3545 dinB -40 6.1 TACTGTACGTTTATACAGTA
Rmet_4549 uvrA -150 6.1 CACTGTATGTTCATACAGTA
Rmet_0742 PF04055 -48 6.5 TACTGTATATTTATACAGTA
Rmet_1637 BPSS1334 -43 5.2 AACTGTATGGATGAACAGTC
Rmet_1637 BPSS1334 -62 6.3 CACTGTATATATTTACAGTA
Rmet_5910 H16_B2553 -42 6.3 CACTGTATATTTATACAGTG
Ralstonia eutropha JMP134
Reut_B4525 imuA 91 6.3 TACTGTATAAATATACAGTT
Reut_A0527 recA -194 6.1 TACTGTTTTTTTATACAGTA
Reut_A2008 lexA -74 6 TACTGTTTAAACATACAGTG
Reut_A2008 lexA -95 5 TACTGTATAAAATCACAGGC
Reut_A0283 uvrD -6 5.7 GCCTGTATGGATATACAGTT
Reut_A1285 H16_A1352 125 5.9 TACTGTACATCCATACAGTA
Reut_B5827 PF06733 -44 6.1 GACTGTATATTCATACAGTT
Reut_B3817 BPSS1334 -31 5.3 ACCTGTATGGATAAACAGTG
Reut_B3817 BPSS1334 -50 6.4 TACTGTATATATTTACAGTA
Reut_B4240 uvrA -160 5.6 CACTGTACGGATATACAGTC
Reut_B5317 H16_B2553 -51 6 GACTGTATATTCGTACAGTA
Ralstonia eutropha H16
H16_B1060 imuA -72 6.3 TACTGTATAAATATACAGTT
H16_A0544 recA -159 6.1 TACTGTTTTTTTATACAGTA
H16_A2281 lexA -101 6 TACTGTTTAAACATACAGTG
H16_A2281 lexA -121 5.4 TACTGTATAAAATCACAGCA
H16_A0305 uvrD -68 5.7 CCCTGTATGGATATACAGTT
H16_A1352 H16_A1352 41 5.9 TACTGTACATCCATACAGTA
H16_B1265 PF06733 -103 6.3 TACTGTATATTCATACAGTT
H16_B0943 BPSS1334 -32 5.3 ACCTGTATGGATGAACAGTA
H16_B0943 BPSS1334 -51 6.4 TACTGTATATATTTACAGTA
H16_B1571 uvrA -72 5.7 GACTGTATGGATGTACAGTG
H16_B2553 H16_B2553 -51 6 GACTGTATATTCGTACAGTA
H16_A0887 PF04055 -44 6.5 TACTGTATATATATACAGTG
Cupriavidus taiwanensis
RALTA_B0872 imuA -72 6.3 TACTGTATAAATATACAGTT
RALTA_A0499 recA -159 6.1 TACTGTTTTTTTATACAGTA
RALTA_A1825 lexA -98 6 TACTGTTTAAACATACAGTG
RALTA_A1825 lexA -118 5.4 TACTGTATAAAATCACAGCA
RALTA_A0247 uvrD -62 5.6 GGCTGTATGGATATACAGTT
RALTA_A1272 H16_A1352 -33 5.9 TACTGTACATCCATACAGTA
RALTA_B1170 PF06733 -88 6.2 TACTGTATATTTGTACAGTT
RALTA_A3210 dinD -68 6.3 CACTGTATATTCATACAGTA
RALTA_B0767 BPSS1334 -48 5.1 ACCTGTATGGATGAACAGTG
RALTA_B0767 BPSS1334 -67 6.4 TACTGTATATATTTACAGTA
pRALTA_0101 imuA -41 6.3 AACTGTATAAATATACAGTA
RALTA_B1379 uvrA -71 5.7 GACTGTATGGATGTACAGTG
RALTA_B2284 H16_B2553 -42 6 GACTGTATATTCGTACAGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD