Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Ralstonia

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia solanacearum GMI1000
RS04257 iscR -36 6.5 ATACTTGAGCAAAACGATCAGGTAT
RS04257 iscR -65 6.3 TTAGTTGACTGATTTTGTCGGGTTC
Ralstonia pickettii 12J
Rpic_0883 iscR -66 6.3 TTAGTTGACCGATTTTGTCGGGTTC
Rpic_0883 iscR -37 6.5 ATACTTGAGCAAAACGATCAGGTAT
Ralstonia metallidurans CH34
Rmet_1024 iscR -40 6.2 ATACTCGACCGAAATCCTCAAGTAT
Rmet_1024 iscR -69 5.9 GTACTTGACTGATTTAGTCGGAAAA
Ralstonia eutropha JMP134
Reut_A1057 iscR -37 6.8 ATACTTGACGGAAACGATCAAGTAT
Reut_A1057 iscR -66 6.9 GTAGTTGACTGAAATAGTCGGGTAC
Ralstonia eutropha H16
H16_A1157 iscR -51 6.8 ATACTTGACGGAAACGATCAAGTAT
H16_A1157 iscR -80 6.9 GTAGTTGACTGAATTAGTCGGGTAC
Cupriavidus taiwanensis
RALTA_A1138 iscR -92 6.9 GTAGTTGACTGAATTAGTCGGGTAC
RALTA_A1138 iscR -63 6.8 ATACTTGACGGAAACGATCAAGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD