Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Ralstonia solanacearum GMI1000

Properties
Regulator type: Transcription factor
TF locus tag: RSc0048
Regulator family: FUR
Regulation mode:
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Ralstonia
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -114
Score: 6.1
Sequence: TATTTGCAACAGAGTTGCAAATT
Locus tag: RS00125
Name: omr2
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: RS00126
Name: RSc2728
Funciton: hypothetical protein
omr2
predicted zinc-related TonB-dependent outer membrane transporter
RSc2728
hypothetical protein

Position: -95
Score: 5.7
Sequence: AATTCGCAACTTAGTTGCATTGG
Locus tag: RS04852
Name: RSc0594
Funciton: hypothetical transmembrane protein
Locus tag: RS04851
Name: omr
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
RSc0594
hypothetical transmembrane protein
omr
predicted zinc-related TonB-dependent outer membrane transporter

Position: -220
Score: 6
Sequence: TTGTCGCAACACTGTTGCATGAA
Locus tag: RSc1963
Name: tonB
Funciton: Component of outer membrane metal uptake system, TonB family
Locus tag: RSc1964
Name: exbB
Funciton: Component of outer membrane metal uptake system, ExbB family
Locus tag: RSc1965
Name: exbD
Funciton: Component of outer membrane metal uptake system, ExbD family
tonB
Component of outer membrane metal uptake system, TonB family
exbB
Component of outer membrane metal uptake system, ExbB family
exbD
Component of outer membrane metal uptake system, ExbD family

Position: -37
Score: 5.9
Sequence: TTCTTGCAACTCTGTTGCGTTTG
Locus tag: RS01372
Name: zip
Funciton: Zinc transporter, ZIP family
zip
Zinc transporter, ZIP family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD