Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Ralstonia pickettii 12J

Properties
Regulator type: Transcription factor
TF locus tag: Rpic_3702
Regulator family: FUR
Regulation mode:
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Ralstonia
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -31
Score: 5.7
Sequence: AATTCGCAACTTAGTTGCATTGG
Locus tag: Rpic_0521
Name: null
Funciton: hypothetical transmembrane protein
Locus tag: Rpic_0522
Name: omr
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
hypothetical transmembrane protein
omr
predicted zinc-related TonB-dependent outer membrane transporter

Position: -223
Score: 5.9
Sequence: TTGTCGCAACACTGTTGCAGTTG
Locus tag: Rpic_2116
Name: tonB
Funciton: Component of outer membrane metal uptake system, TonB family
Locus tag: Rpic_2117
Name: exbB
Funciton: Component of outer membrane metal uptake system, ExbB family
Locus tag: Rpic_2118
Name: exbD
Funciton: Component of outer membrane metal uptake system, ExbD family
tonB
Component of outer membrane metal uptake system, TonB family
exbB
Component of outer membrane metal uptake system, ExbB family
exbD
Component of outer membrane metal uptake system, ExbD family

Position: -50
Score: 5.2
Sequence: CAATTGCAACTCAATTGCAGCAA
Locus tag: Rpic_3702
Name: zur
Funciton: Zinc uptake regulator, Fur family
Locus tag: Rpic_3703
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
zur
Zinc uptake regulator, Fur family
yciC
Putative zinc chaperone, COG0523 family

Position: -48
Score: 6
Sequence: TTCTTGCAACTCTGTTGCGTTTA
Locus tag: Rpic_2432
Name: zip
Funciton: Zinc transporter, ZIP family
zip
Zinc transporter, ZIP family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD