Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Ralstonia metallidurans CH34

Properties
Regulator type: Transcription factor
TF locus tag: Rmet_0128
Regulator family: FUR
Regulation mode:
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Ralstonia
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -99
Score: 5.6
Sequence: GAAATGCAACAAGGTTGCATTTA
Position: -71
Score: 6.1
Sequence: TGTTTGCAACAATGTTGCATTAA
Locus tag: Rmet_1098
Name: yciC2
Funciton: Putative zinc chaperone, COG0523 family
yciC2
Putative zinc chaperone, COG0523 family

Position: -34
Score: 6.1
Sequence: CAGTCGCAACTTTGTTGCATCAA
Locus tag: Rmet_0125
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: Rmet_0124
Name: null
Funciton: hypothetical transmembrane protein
Locus tag: Rmet_0123
Name: omr
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
yciC
Putative zinc chaperone, COG0523 family
hypothetical transmembrane protein
omr
predicted zinc-related TonB-dependent outer membrane transporter

Position: -26
Score: 6.4
Sequence: TTTTTGCAACATTGTTGCGTTAA
Locus tag: Rmet_2621
Name: zip
Funciton: Zinc transporter, ZIP family
zip
Zinc transporter, ZIP family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD