Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Ralstonia eutropha H16

Properties
Regulator type: Transcription factor
TF locus tag: h16_A0196
Regulator family: FUR
Regulation mode:
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Ralstonia
Statistics of regulated genes:
- Genes 9
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 5.5
Sequence: CAATTGCAATTGAGTTGCGTTAA
Locus tag: H16_B2121
Name: h16_B2121
Funciton: hypothetical protein
Locus tag: H16_B2120
Name: omr3
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: H16_B2119
Name: h16_B2119
Funciton: ABC-type transporter, ATPase component
Locus tag: H16_B2118
Name: h16_B2118
Funciton: hypothetical membrane spanning protein
Locus tag: H16_B2117
Name: h16_B2117
Funciton: ABC-type transporter, permease component
h16_B2121
hypothetical protein
omr3
predicted zinc-related TonB-dependent outer membrane transporter
h16_B2119
ABC-type transporter, ATPase component
h16_B2118
hypothetical membrane spanning protein
h16_B2117
ABC-type transporter, permease component

Position: -75
Score: 6
Sequence: AATTCGCAACCTTGTTGCAACAA
Locus tag: H16_A0193
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: H16_A0192
Name: h16_A0192
Funciton: hypothetical transmembrane protein
Locus tag: H16_A0191
Name: omr
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
yciC
Putative zinc chaperone, COG0523 family
h16_A0192
hypothetical transmembrane protein
omr
predicted zinc-related TonB-dependent outer membrane transporter

Position: -35
Score: 6.4
Sequence: TTATTGCAACATTGTTGCGTTAG
Locus tag: H16_A2738
Name: zip
Funciton: Zinc transporter, ZIP family
zip
Zinc transporter, ZIP family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD