Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Oceanobacillus iheyensis HTE831

Properties
Regulator type: Transcription factor
TF locus tag: OB2398
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bacillales
Statistics of regulated genes:
- Genes 10
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 67 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -57
Score: 6.2
Sequence: TAAATCGTAACCATTACGAATCG
Position: -41
Score: 6
Sequence: CGAATCGTAATCATTACGATTAC
Locus tag: OB1278
Name: zinT
Funciton: candidate zinc-binding lipoprotein
zinT
candidate zinc-binding lipoprotein

Position: -82
Score: 6.3
Sequence: TTAATCGTAATGATTACGTTTTT
Locus tag: OB3429
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -247
Score: 6
Sequence: TTAATCGTAATCGTTACGATGTA
Locus tag: OB3432
Name: rpsN2
Funciton: 30S ribosomal protein S14
Locus tag: OB3431
Name: null
Funciton: hypothetical protein
Locus tag: OB3430
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpsN2
30S ribosomal protein S14
hypothetical protein
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -55
Score: 5
Sequence: TTATTCGTAATGATTACGGATAT
Position: -40
Score: 6.9
Sequence: TAAATCGTAATGATTACGTTTTG
Locus tag: OB3434
Name: OB3434
Funciton: Hypothetical protein
Locus tag: OB3433
Name: null
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
OB3434
Hypothetical protein
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -297
Score: 6
Sequence: TAATTCGTAACGATTCCTATTTA
Position: -274
Score: 5.1
Sequence: CATTTCATAATCATTACGCTATT
Locus tag: OB2396
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: OB2397
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: OB2398
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD