Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bacillus clausii KSM-K16

Properties
Regulator type: Transcription factor
TF locus tag: ABC1704
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bacillales
Statistics of regulated genes:
- Genes 11
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 67 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 5.1
Sequence: TAAATCGGAAGCATTCTGAATAA
Locus tag: ABC1702
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: ABC1703
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: ABC1704
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -54
Score: 6.8
Sequence: CAAAACGTAATAATTACGATTTA
Locus tag: ABC1118
Name: zinT
Funciton: candidate zinc-binding lipoprotein
zinT
candidate zinc-binding lipoprotein

Position: -40
Score: 6.9
Sequence: TAATTCGTAATCATTACGATTTA
Locus tag: ABC4020
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -45
Score: 6.1
Sequence: TAAATCGTAATAATAATGATTTT
Locus tag: ABC4019
Name: rpsN2
Funciton: 30S ribosomal protein S14
rpsN2
30S ribosomal protein S14

Position: -54
Score: 6.8
Sequence: CAAAACGTAATAATTACGATTTA
Locus tag: ABC1118
Name: zinT
Funciton: candidate zinc-binding lipoprotein
Locus tag: ABC1117
Name: adcA
Funciton: Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
Locus tag: ABC1116
Name: adcC
Funciton: Mn2+/Zn2+ ABC transporter ATP-binding protein
Locus tag: ABC1115
Name: adcB
Funciton: Mn2+/Zn2+ ABC transporter permease
zinT
candidate zinc-binding lipoprotein
adcA
Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
adcC
Mn2+/Zn2+ ABC transporter ATP-binding protein
adcB
Mn2+/Zn2+ ABC transporter permease

Position: -85
Score: 6.2
Sequence: TAAATCGTAATTGATACGATTTG
Locus tag: ABC1119
Name: null
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD