Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bacillus halodurans C-125

Properties
Regulator type: Transcription factor
TF locus tag: BH1396
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bacillales
Statistics of regulated genes:
- Genes 9
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 67 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -72
Score: 5
Sequence: TAAATCGGAATGATTCTTAATAT
Locus tag: BH1394
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: BH1395
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: BH1396
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -195
Score: 6.7
Sequence: CAAAGCGTAATTATTACGATTTA
Position: -54
Score: 5.5
Sequence: CAAATCGTAATGATAACTTTTAT
Locus tag: BH1790
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -40
Score: 6.6
Sequence: TAAATAGGAATTATTACGATTTA
Locus tag: BH0366
Name: BH0366
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: BH0367
Name: BH0367
Funciton: NADH-ubiquinone oxidoreductase 51 kDa subunit
Locus tag: BH0368
Name: BH0368
Funciton: Deoxycytidine triphosphate deaminase (EC 3.5.4.13)
Locus tag: BH0369
Name: sufE2
Funciton: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
BH0366
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
BH0367
NADH-ubiquinone oxidoreductase 51 kDa subunit
BH0368
Deoxycytidine triphosphate deaminase (EC 3.5.4.13)
sufE2
Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2

Position: -41
Score: 6.2
Sequence: TAAATCGTAATTATTCTTATTTA
Locus tag: BH0998
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
folE2
GTP cyclohydrolase I (EC 3.5.4.16) type 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD