Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bacillus cereus ATCC 14579

Properties
Regulator type: Transcription factor
TF locus tag: BC4277
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bacillales
Statistics of regulated genes:
- Genes 6
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 67 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 6
Sequence: TAAATCGGAATCATTCTGAATTA
Locus tag: BC4279
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: BC4278
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: BC4277
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -93
Score: 6.9
Sequence: TAAATCGTAATCATTATGATTTA
Position: -39
Score: 7
Sequence: TAAAACGTAATCATTACGATTTA
Locus tag: BC1705
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -55
Score: 7
Sequence: TAAATCGTAATCATTACGTTTTA
Locus tag: BC4339
Name: rpmGA1
Funciton: 50S ribosomal protein L33
rpmGA1
50S ribosomal protein L33

Position: -68
Score: 6.7
Sequence: TAAATCGTAATTATTACGCTTTG
Locus tag: BC1926
Name: null
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD