Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Geobacillus kaustophilus HTA426

Properties
Regulator type: Transcription factor
TF locus tag: GK2469
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bacillales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 67 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 5.8
Sequence: CAAATCGGAATGATTCTGAATTA
Locus tag: GK2471
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: GK2470
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: GK2469
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD