Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bacillus amyloliquefaciens FZB42

Properties
Regulator type: Transcription factor
TF locus tag: RBAM_023410
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bacillales
Statistics of regulated genes:
- Genes 8
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 67 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -103
Score: 6.6
Sequence: TAAATAGTAACGATTACGATTTA
Position: -38
Score: 5.7
Sequence: TAAATCGTAATCATTCTATTTTG
Locus tag: RBAM_003550
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -37
Score: 6.7
Sequence: CAAAACGTAATTATTACGATTTG
Locus tag: RBAM_009150
Name: rpsN2
Funciton: 30S ribosomal protein S14
rpsN2
30S ribosomal protein S14

Position: -40
Score: 6.8
Sequence: TAAAACGTAATAATTACGATTTG
Locus tag: RBAM_022140
Name: rpmGA1
Funciton: 50S ribosomal protein L33
rpmGA1
50S ribosomal protein L33

Position: -39
Score: 6.8
Sequence: TAAAACGTAATTATTACGATTTG
Locus tag: RBAM_027710
Name: rpmE2
Funciton: 50S ribosomal protein L31 type B
Locus tag: RBAM_027700
Name: ytiB
Funciton: Carbonic anhydrase (EC 4.2.1.1)
rpmE2
50S ribosomal protein L31 type B
ytiB
Carbonic anhydrase (EC 4.2.1.1)

Position: -105
Score: 5.8
Sequence: CAAAACGTAATTACTTCGTTTTA
Position: -42
Score: 5.5
Sequence: GAAATCGTCATCATTCTGATTTA
Locus tag: RBAM_003110
Name: adcA
Funciton: Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
Locus tag: RBAM_003120
Name: adcC
Funciton: Mn2+/Zn2+ ABC transporter ATP-binding protein
Locus tag: RBAM_003130
Name: adcB
Funciton: Mn2+/Zn2+ ABC transporter permease
adcA
Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
adcC
Mn2+/Zn2+ ABC transporter ATP-binding protein
adcB
Mn2+/Zn2+ ABC transporter permease
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD