Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LicR in Bacillus clausii KSM-K16

Properties
Regulator type: Transcription factor
TF locus tag: ABC0485
Regulator family: BglG
Regulation mode: activator
Biological process: Beta-glucosides utilization
Effector: HPr, phosphocarrier protein; LicB, lichenan-specific enzyme IIB PTS component
Regulog: LicR - Bacillales
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -123
Score: 5.4
Sequence: TTTTCCGTTTATATGGCTAAA
Locus tag: ABC0481
Name: licB
Funciton: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: ABC0482
Name: licC
Funciton: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
Locus tag: ABC0483
Name: licA
Funciton: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
Locus tag: ABC0484
Name: licH
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: ABC0485
Name: licR
Funciton: Transcriptional antiterminator of lichenan operon, BglG family
licB
PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
licC
PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
licA
PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
licH
6-phospho-beta-glucosidase (EC 3.2.1.86)
licR
Transcriptional antiterminator of lichenan operon, BglG family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD