Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Bacillus licheniformis DSM 13

Properties
Regulator type: Transcription factor
TF locus tag: BLi02741
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Bacillales
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -41
Score: 7.3
Sequence: TTAGCACTCAGTTGTGCCGAGTGCTAA
Locus tag: BLi02741
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: BLi02740
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: BLi02739
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA
Heat-inducible transcription repressor HrcA
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK

Position: -61
Score: 7.3
Sequence: TTAGCACTCACCGAGTGCGAGTGCTAA
Locus tag: BLi00623
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: BLi00624
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES
Co-chaperonin GroES (HSP10 family)
groEL
Chaperonin GroEL (HSP60 family)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD