Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ChiR in Thermosipho melanesiensis BI429

Properties
Regulator type: Transcription factor
TF locus tag: Tmel_0688
Regulator family: ROK
Regulation mode: repressor
Biological process: Chitobiose utilization
Effector: Chitobiose
Regulog: ChiR - Thermotogales
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -38
Score: 6.9
Sequence: TAGTTGATTGAAGCAATCAACTA
Locus tag: Tmel_0688
Name: chiR
Funciton: Regulator of chitobiose utilization ChiR, ROK family
Locus tag: Tmel_0689
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: Tmel_0690
Name: chiX
Funciton: Predicted chitobiose ABC transport system II, sugar-binding protein
Locus tag: Tmel_0691
Name: chiY
Funciton: Predicted chitobiose ABC transport system II, permease protein 1
Locus tag: Tmel_0692
Name: chiZ
Funciton: Predicted chitobiose ABC transport system, permease protein 2
Locus tag: Tmel_0693
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Locus tag: Tmel_0694
Name: null
Funciton: N-acetylglucosamine-6-phosphate deacetylase
chiR
Regulator of chitobiose utilization ChiR, ROK family
cbsA
Beta-hexosaminidase (EC 3.2.1.52)
chiX
Predicted chitobiose ABC transport system II, sugar-binding protein
chiY
Predicted chitobiose ABC transport system II, permease protein 1
chiZ
Predicted chitobiose ABC transport system, permease protein 2
nagB
Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
N-acetylglucosamine-6-phosphate deacetylase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD