Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ChiR in Thermotoga maritima MSB8

Properties
Regulator type: Transcription factor
TF locus tag: TM0808
Regulator family: ROK
Regulation mode: repressor
Biological process: Chitobiose utilization
Effector: Chitobiose
Regulog: ChiR - Thermotogales
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -27
Score: 6.9
Sequence: AAGTTGTTTGCGGCATGCAACTA
Locus tag: TM0808
Name: chiR
Funciton: Regulator of chitobiose utilization ChiR, ROK family
Locus tag: TM0809
Name: cbsA
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: TM0810
Name: chiE
Funciton: Predicted chitobiose ABC transport system, sugar-binding protein
Locus tag: TM0811
Name: chiF
Funciton: Predicted chitobiose ABC transport system, permease protein 1
Locus tag: TM0812
Name: chiG
Funciton: Predicted chitobiose ABC transport system, permease protein 2
Locus tag: TM0813
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Locus tag: TM0814
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
chiR
Regulator of chitobiose utilization ChiR, ROK family
cbsA
Beta-hexosaminidase (EC 3.2.1.52)
chiE
Predicted chitobiose ABC transport system, sugar-binding protein
chiF
Predicted chitobiose ABC transport system, permease protein 1
chiG
Predicted chitobiose ABC transport system, permease protein 2
nagB
Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagA
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD