Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Thermotoga lettingae TMO

Properties
Regulator type: Transcription factor
TF locus tag: Tlet_1138
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Thermotogales
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 35 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -169
Score: 5
Sequence: TAATTTGTATGTACATATAT
Locus tag: Tlet_1143
Name: araN-II
Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: Tlet_1144
Name: araP-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: Tlet_1145
Name: araQ-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: Tlet_1146
Name: xynB
Funciton: Endo-1,4-beta-xylanase
Locus tag: Tlet_1147
Name: abf3
Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
Locus tag: Tlet_1148
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tlet_1149
Name: araA-II
Funciton: Predicted L-arabinose isomerase (EC 5.3.1.4)
Locus tag: Tlet_1150
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
araN-II
Predicted arabinose ABC transporter, substrate binding protein
araP-II
Alpha-arabinosides ABC transport system, permease protein 1
araQ-II
Alpha-arabinosides ABC transport system, permease protein 2
xynB
Endo-1,4-beta-xylanase
abf3
Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
abfA
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA-II
Predicted L-arabinose isomerase (EC 5.3.1.4)
araB
Ribulokinase (EC 2.7.1.16)

Position: 27
Score: 5.3
Sequence: ATTTATGTACGTACGTTTAC
Locus tag: Tlet_1138
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization operon, GntR family
Locus tag: Tlet_1139
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araR
Transcriptional repressor of arabinoside utilization operon, GntR family
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD