Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Thermotoga naphthophila RKU-10

Properties
Regulator type: Transcription factor
TF locus tag: Tnap_0905
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Thermotogales
Statistics of regulated genes:
- Genes 10
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 35 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -150
Score: 6.5
Sequence: ATAAAAGTACGTACCTTTAT
Position: -48
Score: 4.7
Sequence: CCATCGGTACGTACCGTTAT
Locus tag: Tnap_0907
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
araE
Predicted arabinosides or arabinose ABC transport system, substrate-binding protein

Position: -164
Score: 4.7
Sequence: ATAACGGTACGTACCGATGG
Position: -62
Score: 6.5
Sequence: ATAAAGGTACGTACTTTTAT
Locus tag: Tnap_0906
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA
L-arabinose isomerase (EC 5.3.1.4)

Position: -56
Score: 4.9
Sequence: TATAATGTACGTACCTATCA
Position: -55
Score: 5
Sequence: GATAATATACGTACCTAAAT
Locus tag: Tnap_0910
Name: glsA
Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
Locus tag: Tnap_0911
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tnap_0912
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: Tnap_0913
Name: Tnap_0913
Funciton: predicted arabinose ABC transporter, sugar-binding protein
Locus tag: Tnap_0914
Name: Tnap_0914
Funciton: predicted arabinose ABC transporter, permease component
Locus tag: Tnap_0915
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: Tnap_0916
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Tnap_0917
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
glsA
Putative glycosyl hydrolase of unknown function (DUF1680)
abfA
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araM
L-arabinose-specific 1-epimerase (mutarotase)
Tnap_0913
predicted arabinose ABC transporter, sugar-binding protein
Tnap_0914
predicted arabinose ABC transporter, permease component
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araB
Ribulokinase (EC 2.7.1.16)
araW
Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD