Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Thermotoga petrophila RKU-1

Properties
Regulator type: Transcription factor
TF locus tag: Tpet_0649
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Thermotogales
Statistics of regulated genes:
- Genes 22
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 35 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -150
Score: 6.5
Sequence: ATAAAAGTACGTACCTTTAT
Position: -48
Score: 4.7
Sequence: CCATCGGTACGTACCGTTAT
Locus tag: Tpet_0647
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: Tpet_0646
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: Tpet_0645
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: Tpet_0644
Name: araG
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2
araE
Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
araE
Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
araF
Predicted arabinosides or arabinose ABC transport system, permease protein 1
araG
Predicted arabinosides or arabinose ABC transport system, permease protein 2

Position: -221
Score: 5.7
Sequence: AGATAGGTACGTACCAATTT
Position: -38
Score: 5.4
Sequence: ATATATGTACGTACAAAATG
Locus tag: Tpet_0637
Name: abf6
Funciton: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tpet_0638
Name: lamG1
Funciton: Laminin G domain-containing protein
Locus tag: Tpet_0639
Name: abf6
Funciton: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tpet_0640
Name: conA1
Funciton: Con A-like domain-containing protein
Locus tag: Tpet_0641
Name: conA2
Funciton: Con A-like domain-containing protein
Locus tag: Tpet_0642
Name: lamG2
Funciton: Laminin G domain-containing protein
abf6
Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
lamG1
Laminin G domain-containing protein
abf6
Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
conA1
Con A-like domain-containing protein
conA2
Con A-like domain-containing protein
lamG2
Laminin G domain-containing protein

Position: -164
Score: 4.7
Sequence: ATAACGGTACGTACCGATGG
Position: -62
Score: 6.5
Sequence: ATAAAGGTACGTACTTTTAT
Locus tag: Tpet_0648
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA
L-arabinose isomerase (EC 5.3.1.4)

Position: -55
Score: 5
Sequence: GATAATATACGTACCTAAAT
Locus tag: Tpet_0643
Name: glsA
Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
glsA
Putative glycosyl hydrolase of unknown function (DUF1680)

Position: -233
Score: 5.4
Sequence: CATTTTGTACGTACATATAT
Position: -50
Score: 5.7
Sequence: AAATTGGTACGTACCTATCT
Locus tag: Tpet_0636
Name: araN-II
Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: Tpet_0635
Name: araP-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: Tpet_0634
Name: araQ-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: Tpet_0633
Name: abf3
Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
Locus tag: Tpet_0632
Name: xylX
Funciton: Secreted glycosyl hydrolase, similar to xylosidase
Locus tag: Tpet_0631
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tpet_0630
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: Tpet_0629
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: Tpet_0628
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Tpet_0627
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
araN-II
Predicted arabinose ABC transporter, substrate binding protein
araP-II
Alpha-arabinosides ABC transport system, permease protein 1
araQ-II
Alpha-arabinosides ABC transport system, permease protein 2
abf3
Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
xylX
Secreted glycosyl hydrolase, similar to xylosidase
abfA
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araM
L-arabinose-specific 1-epimerase (mutarotase)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araB
Ribulokinase (EC 2.7.1.16)
araW
Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD