Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Thermotoga neapolitana DSM 4359

Properties
Regulator type: Transcription factor
TF locus tag: CTN_0410
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Thermotogales
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 35 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -136
Score: 6.2
Sequence: ACAAAAGTACGTACCTTTAT
Position: -33
Score: 4.7
Sequence: CAACTGGTACGTACCGATAT
Locus tag: CTN_0408
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: CTN_0406
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
araE
Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
araF
Predicted arabinosides or arabinose ABC transport system, permease protein 1

Position: -165
Score: 4.7
Sequence: ATATCGGTACGTACCAGTTG
Position: -62
Score: 6.2
Sequence: ATAAAGGTACGTACTTTTGT
Locus tag: CTN_0409
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA
L-arabinose isomerase (EC 5.3.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD