Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Thermotoga maritima MSB8

Properties
Regulator type: Transcription factor
TF locus tag: TM0275
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Thermotogales
Statistics of regulated genes:
- Genes 9
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 35 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -1498
Score: 6.3
Sequence: ATAAAaGTACGTACCaTTAT
Position: -1396
Score: 4.7
Sequence: ccAtcGGTACGTACCgTTAT
Locus tag: TM0278
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: TM0279
Name: araG
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2
araF
Predicted arabinosides or arabinose ABC transport system, permease protein 1
araG
Predicted arabinosides or arabinose ABC transport system, permease protein 2

Position: -44
Score: 5.9
Sequence: AATAATGTACGTACCTAAAT
Locus tag: TM0280
Name: glsA
Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
Locus tag: TM0281
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: TM0282
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: TM0283
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: TM0284
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: TM0285
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
glsA
Putative glycosyl hydrolase of unknown function (DUF1680)
abfA
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araM
L-arabinose-specific 1-epimerase (mutarotase)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araB
Ribulokinase (EC 2.7.1.16)
araW
Predicted glycerol-1-phosphate dehydrogenase, arabinose operon

Position: -164
Score: 4.7
Sequence: ATAACGGTACGTACCGATGG
Position: -62
Score: 6.3
Sequence: ATAATGGTACGTACTTTTAT
Locus tag: TM0276
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA
L-arabinose isomerase (EC 5.3.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD