Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TreR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA0434
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose-6-phosphate
Regulog: TreR - Staphylococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 7
Sequence: ATAACTTGTCTAGACAAGTTAT
Locus tag: SA0432
Name: treP
Funciton: phosphotransferase system trehalose-specific enzyme IIBC component homolog
Locus tag: SA0433
Name: treA
Funciton: trehalose-6-phosphate hydrolase
Locus tag: SA0434
Name: treR
Funciton: trehalose-6-phosphate-responsive transcriptional regulator
treP
phosphotransferase system trehalose-specific enzyme IIBC component homolog
treA
trehalose-6-phosphate hydrolase
treR
trehalose-6-phosphate-responsive transcriptional regulator
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD