Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR2 in Staphylococcus carnosus subsp. carnosus TM300

Properties
Regulator type: Transcription factor
TF locus tag:
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR2 - Staphylococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -103
Score: 5.4
Sequence: ATATGAAAGCGTATACATAT
Locus tag: Sca_2421
Name: rbsU
Funciton: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
Locus tag: Sca_2420
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Sca_2419
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsU
Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsK
Ribokinase (EC 2.7.1.15)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD