Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type: Transcription factor
TF locus tag: SSP1245
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Staphylococcaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -106
Score: 6.4
Sequence: TCGCGCAAACGTTTGCACAA
Locus tag: SSP1245
Name: malR
Funciton: Maltose operon transcriptional repressor MalR, LacI family
Locus tag: SSP1246
Name: malA
Funciton: Alpha-glucosidase (EC 3.2.1.20)
malR
Maltose operon transcriptional repressor MalR, LacI family
malA
Alpha-glucosidase (EC 3.2.1.20)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD