Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1339
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Staphylococcaceae
Statistics of regulated genes:
- Genes 9
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -112
Score: 6.9
Sequence: TTATGCAATCGTTTGCACAA
Locus tag: SA1339
Name: malR
Funciton: Maltose operon transcriptional repressor MalR, LacI family
Locus tag: SA1338
Name: malA
Funciton: Alpha-glucosidase (EC 3.2.1.20)
malR
Maltose operon transcriptional repressor MalR, LacI family
malA
Alpha-glucosidase (EC 3.2.1.20)

Position: -66
Score: 6.7
Sequence: TTGTGCAAACGTTTTCACAA
Locus tag: SA0206
Name: mdxK
Funciton: Maltose/maltodextrin transport ATP-binding protein
Locus tag: SA0207
Name: mdxE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
Locus tag: SA0208
Name: mdxF
Funciton: Maltose/maltodextrin ABC transporter, permease protein
Locus tag: SA0209
Name: mdxG
Funciton: Maltose/maltodextrin ABC transporter, permease protein
Locus tag: SA0210
Name: gfoA
Funciton: putative glucose dehydrogenase A
Locus tag: SA0211
Name: gfoB
Funciton: putative glucose dehydrogenase B
Locus tag: SA0212
Name: gfoI
Funciton: putative sugar isomerase
mdxK
Maltose/maltodextrin transport ATP-binding protein
mdxE
Maltose/maltodextrin ABC transporter, substrate binding protein
mdxF
Maltose/maltodextrin ABC transporter, permease protein
mdxG
Maltose/maltodextrin ABC transporter, permease protein
gfoA
putative glucose dehydrogenase A
gfoB
putative glucose dehydrogenase B
gfoI
putative sugar isomerase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD