Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Clostridium difficile 630

Properties
Regulator type: Transcription factor
TF locus tag: CD1278
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Clostridia-2
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -98
Score: 6
Sequence: TTAATCTTGACAAAATTAGTAGGGTATAA
Position: -53
Score: 5.4
Sequence: GTAATTCCTACTAAAACAGTATGAATTAG
Locus tag: CD1278
Name: iscR
Funciton: Iron-sulfur cluster assembly transcription factor IscR
Locus tag: CD1279
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: CD1280
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
iscR
Iron-sulfur cluster assembly transcription factor IscR
iscS
Cysteine desulfurase (EC 2.8.1.7)
iscU
Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD