Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbkR in Haloferax volcanii DS2

Properties
Regulator type: Transcription factor
TF locus tag: HVO_0326
Regulator family: [Other]
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: RbkR - Halobacteriales
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 4.9
Sequence: GCATTCCACTTACGATACGC
Locus tag: HVO_0326
Name: rbkR
Funciton: DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
Locus tag: HVO_0327
Name: ribB
Funciton: 3,4-dihydroxy-2-butanone 4-phosphate synthase
rbkR
DNA-binding HTH domain in riboflavin kinase / CTP-dependent archaeal riboflavin kinase
ribB
3,4-dihydroxy-2-butanone 4-phosphate synthase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD