Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbkR in Thermococcus kodakaraensis KOD1

Properties
Regulator type: Transcription factor
TF locus tag: TK1272
Regulator family: [Other]
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: RbkR - Thermococcales
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -62
Score: 6.1
Sequence: TTGTTCTATGTATGGAACAA
Locus tag: TK2194
Name: ribU
Funciton: Substrate-specific component RibU of riboflavin ECF transporter
ribU
Substrate-specific component RibU of riboflavin ECF transporter

Position: -52
Score: 6
Sequence: TTGTTCCAACCTTGGAACAA
Locus tag: TK0424
Name: ribD
Funciton: Diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) / 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193)
Locus tag: TK0425
Name: ribE
Funciton: Riboflavin synthase alpha chain (EC 2.5.1.9)
ribD
Diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) / 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193)
ribE
Riboflavin synthase alpha chain (EC 2.5.1.9)

Position: -62
Score: 5.8
Sequence: TGATTCCATTTTTGGAACAA
Position: -40
Score: 4.6
Sequence: TTTTTAAAAATTTAGAACAT
Locus tag: TK0428
Name: ribBA
Funciton: 3,4-dihydroxy-2-butanone 4-phosphate synthase / GTP cyclohydrolase II (EC 3.5.4.25)
Locus tag: TK0429
Name: ribH
Funciton: 6,7-dimethyl-8-ribityllumazine synthase (EC 2.5.1.9)
ribBA
3,4-dihydroxy-2-butanone 4-phosphate synthase / GTP cyclohydrolase II (EC 3.5.4.25)
ribH
6,7-dimethyl-8-ribityllumazine synthase (EC 2.5.1.9)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD