Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbkR in Pyrococcus abyssi GE5

Properties
Regulator type: Transcription factor
TF locus tag: PAB0917
Regulator family: [Other]
Regulation mode:
Biological process: Riboflavin biosynthesis
Effector: Flavin mononucleotide
Regulog: RbkR - Thermococcales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -62
Score: 5.5
Sequence: TCGTTCAAAATTTGGAACAT
Locus tag: PAB2198
Name: ribU
Funciton: Substrate-specific component RibU of riboflavin ECF transporter
ribU
Substrate-specific component RibU of riboflavin ECF transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD