Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type: Transcription factor
TF locus tag: Blon_1974, Blon_1979
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 7
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 5.7
Sequence: TATTGAGAAGCGGTTTCAACT
Locus tag: Blon_0841
Name: czcD
Funciton: Cobalt-zinc-cadmium resistance protein CzcD
czcD
Cobalt-zinc-cadmium resistance protein CzcD

Position: -113
Score: 6.1
Sequence: AAATGATAATAATTCTCAATA
Locus tag: Blon_1963
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -43
Score: 6.3
Sequence: TATTGAGAACGATTGTCAGCA
Locus tag: Blon_1757
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Blon_1758
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -45
Score: 5.1
Sequence: TAACGATAATGAATATCATTT
Locus tag: Blon_1974
Name: zur
Funciton: Zinc uptake regulation protein ZUR
zur
Zinc uptake regulation protein ZUR

Position: -37
Score: 5.2
Sequence: ATTTGATAATGGTTATCATTA
Locus tag: Blon_1965
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: Blon_1966
Name: rpmG2
Funciton: LSU ribosomal protein L33p
rpmB2
LSU ribosomal protein L28p
rpmG2
LSU ribosomal protein L33p
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD