Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bifidobacterium longum NCC2705

Properties
Regulator type: Transcription factor
TF locus tag: BL1128
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 5.4
Sequence: AAATGAGAAGCGGTTTCAACT
Locus tag: BL1309
Name: czcD
Funciton: Cobalt-zinc-cadmium resistance protein CzcD
czcD
Cobalt-zinc-cadmium resistance protein CzcD

Position: -112
Score: 6.1
Sequence: AAATGATAATAATTCTCAATA
Locus tag: BL1126
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD