Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bifidobacterium dentium Bd1

Properties
Regulator type: Transcription factor
TF locus tag: BDP_0716
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 10
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -128
Score: 5.7
Sequence: TATTGAGAAGCGATTTCAGTT
Locus tag: BDP_1557
Name: czcD
Funciton: Cobalt-zinc-cadmium resistance protein CzcD
czcD
Cobalt-zinc-cadmium resistance protein CzcD

Position: -67
Score: 6.1
Sequence: TGTTGAGAATCATTCTCATTT
Locus tag: BDP_0392
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -68
Score: 6.4
Sequence: TATTGAGAATGGTTGTCAACA
Locus tag: BDP_0897
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: BDP_0896
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -37
Score: 6.1
Sequence: TATTGATAATGATTATCATTA
Locus tag: BDP_1883
Name: rpmB2
Funciton: LSU ribosomal protein L28p
Locus tag: BDP_1882
Name: rpmG2
Funciton: LSU ribosomal protein L33p
Locus tag: BDP_1881
Name: rpsN2
Funciton: SSU ribosomal protein S14p
Locus tag: BDP_1879
Name: rpmJ2
Funciton: LSU ribosomal protein L36p
Locus tag: BDP_1880
Name: null
Funciton: hypothetical protein
Locus tag: BDP_1878
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
rpmB2
LSU ribosomal protein L28p
rpmG2
LSU ribosomal protein L33p
rpsN2
SSU ribosomal protein S14p
rpmJ2
LSU ribosomal protein L36p
hypothetical protein
zinT
Candidate zinc-binding lipoprotein ZinT
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD