Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bifidobacterium breve DSM 20213

Properties
Regulator type: Transcription factor
TF locus tag: BIFBRE_00816, BIFBRE_00810
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 6
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -211
Score: 5.5
Sequence: AAATGAGAAGCGGTTTCAACA
Locus tag: BIFBRE_01806
Name: czcD
Funciton: Cobalt-zinc-cadmium resistance protein CzcD
czcD
Cobalt-zinc-cadmium resistance protein CzcD

Position: -287
Score: 6.1
Sequence: AAATGATAATAATTCTCAATA
Locus tag: BIFBRE_00824
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -45
Score: 5.1
Sequence: TAACGATAATGAATATCATTT
Locus tag: BIFBRE_00816
Name: zur
Funciton: Zinc uptake regulation protein ZUR
zur
Zinc uptake regulation protein ZUR

Position: -19
Score: 5.7
Sequence: TATTGAGAATTATTATCATTT
Locus tag: BIFBRE_00822
Name: rpsN2
Funciton: SSU ribosomal protein S14p
rpsN2
SSU ribosomal protein S14p

Position: -43
Score: 6.3
Sequence: TATTGAGAACGATTGTCAGCA
Locus tag: BIFBRE_01043
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: BIFBRE_01042
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD