Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type: Transcription factor
TF locus tag: BbifN4_010100006451
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -57
Score: 4.7
Sequence: TATTGAAAATGATTGTAGGAA
Locus tag: BbifN4_010100002259
Name: czcD
Funciton: Cobalt-zinc-cadmium resistance protein CzcD
czcD
Cobalt-zinc-cadmium resistance protein CzcD

Position: -89
Score: 6
Sequence: TAATGATAATAAATCTCAATA
Locus tag: BbifN4_010100006401
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -101
Score: 5.8
Sequence: TAATGAGAATGATTGTCATAG
Locus tag: BbifN4_010100003314
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: BbifN4_010100003309
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: 14
Score: 5.6
Sequence: TTTTGATAATGATTATCATTA
Locus tag: BbifN4_010100006411
Name: rpmB2
Funciton: LSU ribosomal protein L28p
rpmB2
LSU ribosomal protein L28p
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD