Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ThiR in Sulfolobus tokodaii str. 7

Properties
Regulator type: Transcription factor
TF locus tag: ST0179
Regulator family: [Other]
Regulation mode: repressor
Biological process: Thiamine transport; Thiamine biosynthesis
Effector: Thiamine phosphate
Regulog: ThiR - Sulfolobales
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 5.6
Sequence: CATATAAGTAGGTTTATAAG
Locus tag: ST1132
Name: thiT
Funciton: Predicted thiamin transporter ThiT
thiT
Predicted thiamin transporter ThiT

Position: -31
Score: 5.4
Sequence: TATATTAGCTAGTTTATAAT
Locus tag: ST0361
Name: thi4
Funciton: Thiazole biosynthetic enzyme Thi4
thi4
Thiazole biosynthetic enzyme Thi4
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD