Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BgaR in Bifidobacterium dentium Bd1

Properties
Regulator type: Transcription factor
TF locus tag: BDP_0654
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -124
Score: 6
Sequence: TTTTGTTTGCGTAAACATAT
Locus tag: BDP_0659
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
bgaX
Putative beta-galactoside ABC transport system, periplasmic component

Position: -169
Score: 6
Sequence: ATATGTTTACGCAAACAAAA
Locus tag: BDP_0658
Name: abfA1
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
abfA1
Alpha-N-arabinofuranosidase (EC 3.2.1.55)

Position: -270
Score: 5.1
Sequence: TAATGTTTTCGTCATCATAG
Position: -179
Score: 5.5
Sequence: TTCTGATAACGTAAACATTT
Locus tag: BDP_0655
Name: bgaY
Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: BDP_0656
Name: bgaZ
Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: BDP_0657
Name: bgaB
Funciton: Beta-galactosidase (EC 3.2.1.23)
bgaY
Putative beta-galactoside ABC transport system, permease component 2
bgaZ
Putative beta-galactoside ABC transport system, permease component 1
bgaB
Beta-galactosidase (EC 3.2.1.23)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD