Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BgaR in Bifidobacterium breve DSM 20213

Properties
Regulator type: Transcription factor
TF locus tag: BIFBRE_00761
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -208
Score: 5.5
Sequence: AATTGTTTACGTTATCATCA
Locus tag: BIFBRE_00761
Name: bgaR
Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
bgaR
Transcriptional regulator for beta-galactosides utilization, LacI family

Position: -156
Score: 5.3
Sequence: AGATGTTATCGCAACCATAG
Locus tag: BIFBRE_00764
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
bgaX
Putative beta-galactoside ABC transport system, periplasmic component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD