Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BgaR in Bifidobacterium animalis subsp. lactis AD011

Properties
Regulator type: Transcription factor
TF locus tag: BLA_0465
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -191
Score: 5.2
Sequence: AACTGTTTGCGCAATCATGC
Position: -114
Score: 5.9
Sequence: CTATGTTTGCGTAAACATTC
Locus tag: BLA_0464
Name: bgaY
Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: BLA_0463
Name: bgaZ
Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: BLA_0462
Name: bgaB
Funciton: Beta-galactosidase (EC 3.2.1.23)
bgaY
Putative beta-galactoside ABC transport system, permease component 2
bgaZ
Putative beta-galactoside ABC transport system, permease component 1
bgaB
Beta-galactosidase (EC 3.2.1.23)

Position: -83
Score: 6.4
Sequence: ATATGTTTGCGCAAACATAA
Locus tag: BLA_0461
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
bgaX
Putative beta-galactoside ABC transport system, periplasmic component

Position: -174
Score: 5.9
Sequence: GAATGTTTACGCAAACATAG
Position: -97
Score: 5.2
Sequence: GCATGATTGCGCAAACAGTT
Locus tag: BLA_0465
Name: bgaR
Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
bgaR
Transcriptional regulator for beta-galactosides utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD