Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BgaR in Bifidobacterium angulatum DSM 20098

Properties
Regulator type: Transcription factor
TF locus tag: BIFANG_00301
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -176
Score: 6
Sequence: AAATGTTTGCGTTATCATTA
Locus tag: BIFANG_00301
Name: bgaR
Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
bgaR
Transcriptional regulator for beta-galactosides utilization, LacI family

Position: -124
Score: 4.8
Sequence: AAATGGTTTCGTCACCATTT
Position: -35
Score: 6
Sequence: TAATGATAACGCAAACATTT
Locus tag: BIFANG_00302
Name: bgaB
Funciton: Beta-galactosidase (EC 3.2.1.23)
bgaB
Beta-galactosidase (EC 3.2.1.23)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD