Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CymR in Macrococcus caseolyticus JCSC5402

Properties
Regulator type: Transcription factor
TF locus tag: MCCL_1264
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Regulog: CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: 32
Score: 5.5
Sequence: TAATTCTTAgTAtTcTtATAGGAtTac
Locus tag: MCCL_0267
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP
L-cystine uptake protein tcyP

Position: -38
Score: 5.3
Sequence: CTATTCCGAGTAAATTGATATGAATAG
Locus tag: MCCL_1425
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: MCCL_1424
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: MCCL_1423
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA
L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
tcyB
L-cystine uptake ABC transporter, permease protein TcyB
tcyC
L-cystine uptake ABC transporter, ATP-binding protein TcyC

Position: -256
Score: 4.5
Sequence: TATTTCCTAGATAATAAATAATGTATT
Locus tag: MCCL_0131
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080
putative acyl-CoA dehydrogenase

Position: -40
Score: 5.8
Sequence: TATTTCTTACTAAATCTATCGGAATTA
Locus tag: MCCL_0379
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850
putative transporter for thiosulphate

Position: -46
Score: 5.6
Sequence: TAATCCCGAGTTATCTGATAAGAATAA
Locus tag: MCCL_1789
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: MCCL_1790
Name: mccB
Funciton: cystathionine gamma-lyase
Locus tag: MCCL_1791
Name: luxS
Funciton: S-ribosylhomocysteinase
mccA
cystathionine beta-synthase
mccB
cystathionine gamma-lyase
luxS
S-ribosylhomocysteinase

Position: -50
Score: 5.4
Sequence: TAAATCCGATAAGCGTAATAAGAATAA
Locus tag: MCCL_1900
Name: cysK
Funciton: cysteine synthase
cysK
cysteine synthase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD