Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CymR in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type: Transcription factor
TF locus tag: SSP1133
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Regulog: CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes 23
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -63
Score: 4.6
Sequence: ATATCCTTAGTATACGTATCGGATTTC
Locus tag: SSP2329
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP
L-cystine uptake protein tcyP

Position: -37
Score: 5.8
Sequence: TTATTCCGATAAGAATAATAAGAATAG
Locus tag: SSP0242
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: SSP0243
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: SSP0244
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA
L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
tcyB
L-cystine uptake ABC transporter, permease protein TcyB
tcyC
L-cystine uptake ABC transporter, ATP-binding protein TcyC

Position: -41
Score: 5.7
Sequence: CAATTCTTATTAAAACGATAAGAATAA
Locus tag: SSP0459
Name: ssuB
Funciton: sulfonate ABC transporter, ATPase component
Locus tag: SSP0458
Name: ssuA
Funciton: sulfonate ABC transporter, substrate-binding component
Locus tag: SSP0457
Name: ssuC
Funciton: sulfonate ABC transporter, permease component
Locus tag: SSP0456
Name: SA0169
Funciton: putative acyl-CoA dehydrogenase
ssuB
sulfonate ABC transporter, ATPase component
ssuA
sulfonate ABC transporter, substrate-binding component
ssuC
sulfonate ABC transporter, permease component
SA0169
putative acyl-CoA dehydrogenase

Position: -110
Score: 5.1
Sequence: TAAATCTTATCGGTAAAGTAAGGATTT
Locus tag: SSP0622
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080
putative acyl-CoA dehydrogenase

Position: -37
Score: 5.1
Sequence: TTAATCTTATTGATTTTATCGGGAAAG
Locus tag: SSP0834
Name: SA1850
Funciton: putative transporter for thiosulphate
SA1850
putative transporter for thiosulphate

Position: -69
Score: 4.8
Sequence: CATATCCTTGTAATCTGATAAGATTTA
Locus tag: SSP0460
Name: SA0165
Funciton: hypothetical protein
SA0165
hypothetical protein

Position: -159
Score: 5.1
Sequence: TAATTATTACTTATTCTATCGGGTTTA
Locus tag: SSP0751
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS
S-ribosylhomocysteinase

Position: -144
Score: 5.1
Sequence: GTATGCTTACTGAAAAAGTAGGAATTA
Position: -57
Score: 5
Sequence: TAATTCTTATCGGTATAGTAAGGTATT
Locus tag: SSP0252
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: SSP0253
Name: mccB
Funciton: cystathionine gamma-lyase
mccA
cystathionine beta-synthase
mccB
cystathionine gamma-lyase

Position: -55
Score: 5.1
Sequence: TATATCCGATTGAAAAAGTAGGTTTTA
Locus tag: SSP2243
Name: cysK
Funciton: cysteine synthase
cysK
cysteine synthase

Position: -152
Score: 4.5
Sequence: AATAACCTAGTATTCGTATCGGAAATA
Position: -58
Score: 4.6
Sequence: TTAAACCTATTTAGACAATAATTATAA
Locus tag: SSP2408
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: SSP2407
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: SSP2406
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
Locus tag: SSP2405
Name: SSP2405
Funciton: sirohydrochlorin ferrochelatase
Locus tag: SSP2404
Name: sirC
Funciton: Precorrin-2 dehydrogenase
Locus tag: SSP2403
Name: ytnM
Funciton: conserved membrane protein YtnM
Locus tag: SSP2402
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: SSP2401
Name: cysC
Funciton: adenylylsulfate kinase
cysJ
sulfite reductase [NADPH] flavoprotein, alpha-component
cysI
sulfite reductase (NADPH) hemoprotein, beta-component
cysG
uroporphyrin-III C-methyltransferase
SSP2405
sirohydrochlorin ferrochelatase
sirC
Precorrin-2 dehydrogenase
ytnM
conserved membrane protein YtnM
cysD
sulfate adenylyltransferase
cysC
adenylylsulfate kinase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD