Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CymR in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type: Transcription factor
TF locus tag: SH1294
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Regulog: CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes 17
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 5.4
Sequence: TTATCCTTATTAAGTATGTCGGAATTA
Locus tag: SH2589
Name: tcyP
Funciton: L-cystine uptake protein tcyP
tcyP
L-cystine uptake protein tcyP

Position: -41
Score: 5.9
Sequence: TTATTCTGACTAATCTAATAGGAATAT
Locus tag: SH0639
Name: tcyA
Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Locus tag: SH0640
Name: tcyB
Funciton: L-cystine uptake ABC transporter, permease protein TcyB
Locus tag: SH0641
Name: tcyC
Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
tcyA
L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
tcyB
L-cystine uptake ABC transporter, permease protein TcyB
tcyC
L-cystine uptake ABC transporter, ATP-binding protein TcyC

Position: -266
Score: 4.4
Sequence: TAATGTCGAGTGATAAACTAGGTTTAA
Locus tag: SH0767
Name: SA2080
Funciton: putative acyl-CoA dehydrogenase
SA2080
putative acyl-CoA dehydrogenase

Position: -182
Score: 5.6
Sequence: TAATTATTACTTATTTTATCGGATTTA
Locus tag: SH0901
Name: luxS
Funciton: S-ribosylhomocysteinase
luxS
S-ribosylhomocysteinase

Position: -109
Score: 5.4
Sequence: TAATTCATAGTGATTGAGTAAGAATTA
Locus tag: SH2549
Name: mccA
Funciton: cystathionine beta-synthase
Locus tag: SH2548
Name: mccB
Funciton: cystathionine gamma-lyase
mccA
cystathionine beta-synthase
mccB
cystathionine gamma-lyase

Position: -56
Score: 4.9
Sequence: TATATCCGATAGAAAAACTAAGTTTTA
Locus tag: SH2497
Name: cysK
Funciton: cysteine synthase
cysK
cysteine synthase

Position: -48
Score: 4.9
Sequence: TAAAACCGAGTAAACTAATCTAATTAA
Locus tag: SH0419
Name: cysD
Funciton: sulfate adenylyltransferase
Locus tag: SH0420
Name: cysC
Funciton: adenylylsulfate kinase
cysD
sulfate adenylyltransferase
cysC
adenylylsulfate kinase

Position: -152
Score: 4.5
Sequence: TAAAACATAGTATTCTGATATGTTTTG
Position: -68
Score: 5.6
Sequence: TTATTCTGACAATTCTGATAGGTATTA
Locus tag: SH0413
Name: cysH
Funciton: phosphoadenosine phosphosulfate reductase
Locus tag: SH0414
Name: cysJ
Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component
Locus tag: SH0415
Name: cysI
Funciton: sulfite reductase (NADPH) hemoprotein, beta-component
Locus tag: SH0416
Name: cysG
Funciton: uroporphyrin-III C-methyltransferase
Locus tag: SH0417
Name: sirC
Funciton: Precorrin-2 dehydrogenase
Locus tag: SH0418
Name: ytnM
Funciton: conserved membrane protein YtnM
cysH
phosphoadenosine phosphosulfate reductase
cysJ
sulfite reductase [NADPH] flavoprotein, alpha-component
cysI
sulfite reductase (NADPH) hemoprotein, beta-component
cysG
uroporphyrin-III C-methyltransferase
sirC
Precorrin-2 dehydrogenase
ytnM
conserved membrane protein YtnM
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD